Incidental Mutation 'R0945:Pex3'
ID 82068
Institutional Source Beutler Lab
Gene Symbol Pex3
Ensembl Gene ENSMUSG00000019809
Gene Name peroxisomal biogenesis factor 3
Synonyms 2900010N04Rik, 2810027F19Rik, 1700014F15Rik
MMRRC Submission 039084-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0945 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 13399586-13428886 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 13418420 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 79 (A79S)
Ref Sequence ENSEMBL: ENSMUSP00000128512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019945] [ENSMUST00000105539] [ENSMUST00000105541] [ENSMUST00000170376]
AlphaFold Q9QXY9
Predicted Effect probably benign
Transcript: ENSMUST00000019945
AA Change: A79S

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019945
Gene: ENSMUSG00000019809
AA Change: A79S

DomainStartEndE-ValueType
Pfam:Peroxin-3 4 99 9.9e-23 PFAM
Pfam:Peroxin-3 94 363 5.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105539
AA Change: A13S

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101178
Gene: ENSMUSG00000019809
AA Change: A13S

DomainStartEndE-ValueType
Pfam:Peroxin-3 28 298 6.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105541
AA Change: A13S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101180
Gene: ENSMUSG00000019809
AA Change: A13S

DomainStartEndE-ValueType
Pfam:Peroxin-3 28 286 2e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145337
Predicted Effect probably benign
Transcript: ENSMUST00000170376
AA Change: A79S

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128512
Gene: ENSMUSG00000019809
AA Change: A79S

DomainStartEndE-ValueType
Pfam:Peroxin-3 2 97 2.4e-35 PFAM
Pfam:Peroxin-3 94 352 7.3e-75 PFAM
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is involved in peroxisome biosynthesis and integrity. It assembles membrane vesicles before the matrix proteins are translocated. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause Zellweger syndrome (ZWS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal sebaceous gland, hair follicle bulge, and cornea morphology. An increase in B and T cell numbers and mean platelet volume, and vertebral transformation are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,110,481 (GRCm39) M883V probably benign Het
Allc A G 12: 28,609,962 (GRCm39) S212P probably benign Het
Anxa10 A G 8: 62,513,279 (GRCm39) probably benign Het
Apoa2 A G 1: 171,053,268 (GRCm39) probably null Het
Arfgef2 T C 2: 166,668,889 (GRCm39) probably benign Het
Arhgap30 G T 1: 171,230,854 (GRCm39) V204L probably damaging Het
Cd109 T A 9: 78,596,223 (GRCm39) V852E possibly damaging Het
Ceacam5 T A 7: 17,481,269 (GRCm39) Y339N probably damaging Het
Chaf1a A G 17: 56,374,441 (GRCm39) D876G probably damaging Het
Chd9 A G 8: 91,659,630 (GRCm39) K197E possibly damaging Het
Cnr2 A T 4: 135,644,632 (GRCm39) M237L probably benign Het
Dnm2 C A 9: 21,416,956 (GRCm39) Q830K probably damaging Het
Dst T C 1: 34,310,500 (GRCm39) L1615P probably damaging Het
Eid1 A G 2: 125,515,497 (GRCm39) D129G probably damaging Het
Exoc5 A G 14: 49,276,799 (GRCm39) probably benign Het
Greb1 T C 12: 16,723,803 (GRCm39) Y1854C probably benign Het
Il15ra T A 2: 11,723,138 (GRCm39) V54E probably damaging Het
Il4i1 G A 7: 44,489,128 (GRCm39) V306M probably damaging Het
Lrsam1 T C 2: 32,837,921 (GRCm39) D211G probably benign Het
Miga1 A T 3: 152,023,300 (GRCm39) F250L possibly damaging Het
Myrfl C T 10: 116,639,299 (GRCm39) probably benign Het
Nell1 A G 7: 49,869,333 (GRCm39) I203V probably benign Het
Ofcc1 C T 13: 40,362,305 (GRCm39) G206R probably benign Het
Or14j9 G A 17: 37,874,278 (GRCm39) T308I probably benign Het
Or4a15 T C 2: 89,193,599 (GRCm39) Y58C probably damaging Het
Or52u1 T A 7: 104,237,879 (GRCm39) N289K probably damaging Het
Pdxdc1 A G 16: 13,675,296 (GRCm39) L345P probably damaging Het
Pla2r1 A C 2: 60,288,754 (GRCm39) L626R possibly damaging Het
Plcb3 A G 19: 6,932,246 (GRCm39) S1107P probably damaging Het
Ppcdc C T 9: 57,327,441 (GRCm39) probably null Het
Rbak A T 5: 143,159,334 (GRCm39) F573Y probably damaging Het
Rfc1 A G 5: 65,436,052 (GRCm39) probably null Het
Rpl13 C T 8: 123,831,913 (GRCm39) A203V possibly damaging Het
Scn8a A G 15: 100,913,668 (GRCm39) H1020R possibly damaging Het
Slf1 A G 13: 77,251,590 (GRCm39) probably benign Het
Synj1 A G 16: 90,757,333 (GRCm39) L905S possibly damaging Het
Tmem59 T A 4: 107,044,922 (GRCm39) probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Uri1 A T 7: 37,669,103 (GRCm39) D127E probably damaging Het
Usp31 T C 7: 121,269,476 (GRCm39) E489G probably damaging Het
Zfp329 T A 7: 12,545,395 (GRCm39) N43I probably benign Het
Zfp941 C T 7: 140,391,577 (GRCm39) R594H probably damaging Het
Zfy1 T C Y: 725,983 (GRCm39) D594G probably damaging Het
Other mutations in Pex3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Pex3 APN 10 13,428,597 (GRCm39) splice site probably null
IGL02367:Pex3 APN 10 13,400,643 (GRCm39) missense probably benign 0.39
IGL02538:Pex3 APN 10 13,411,344 (GRCm39) missense possibly damaging 0.94
IGL02645:Pex3 APN 10 13,422,173 (GRCm39) missense possibly damaging 0.92
IGL03096:Pex3 APN 10 13,410,407 (GRCm39) splice site probably benign
R0076:Pex3 UTSW 10 13,411,338 (GRCm39) missense probably benign 0.08
R0494:Pex3 UTSW 10 13,403,532 (GRCm39) missense probably damaging 1.00
R4574:Pex3 UTSW 10 13,411,315 (GRCm39) nonsense probably null
R6407:Pex3 UTSW 10 13,422,112 (GRCm39) missense probably damaging 1.00
R7549:Pex3 UTSW 10 13,418,414 (GRCm39) missense probably benign
R7751:Pex3 UTSW 10 13,403,550 (GRCm39) missense possibly damaging 0.67
R8033:Pex3 UTSW 10 13,407,024 (GRCm39) nonsense probably null
R9413:Pex3 UTSW 10 13,410,454 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATTAGGTCATTTATGCGGGCAG -3'
(R):5'- CGGAGTTGTGAAACGAGTTCTCCA -3'

Sequencing Primer
(F):5'- GCGGGCAGTACTTTCTGAAC -3'
(R):5'- aaagtatgtccaatacagacacaag -3'
Posted On 2013-11-08