Incidental Mutation 'R0945:Pdxdc1'
ID82076
Institutional Source Beutler Lab
Gene Symbol Pdxdc1
Ensembl Gene ENSMUSG00000022680
Gene Namepyridoxal-dependent decarboxylase domain containing 1
Synonyms2210010A19Rik
MMRRC Submission 039084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R0945 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13833148-13903131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13857432 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 345 (L345P)
Ref Sequence ENSEMBL: ENSMUSP00000111471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023361] [ENSMUST00000115802] [ENSMUST00000115803] [ENSMUST00000115804]
Predicted Effect probably damaging
Transcript: ENSMUST00000023361
AA Change: L345P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023361
Gene: ENSMUSG00000022680
AA Change: L345P

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 166 310 2.6e-12 PFAM
coiled coil region 610 631 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115802
AA Change: L345P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111468
Gene: ENSMUSG00000022680
AA Change: L345P

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 153 316 1.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115803
AA Change: L322P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111469
Gene: ENSMUSG00000022680
AA Change: L322P

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 190 293 1.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115804
AA Change: L345P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111471
Gene: ENSMUSG00000022680
AA Change: L345P

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 154 308 5.5e-15 PFAM
coiled coil region 610 631 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154150
Meta Mutation Damage Score 0.0444 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype Homozygous mutant mice exhibit behavioral and learning defects including abnormal spontaneous activity, impaired spatial memory, and reduced exploratory activity in the presence of conspecifics.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,111 M883V probably benign Het
Allc A G 12: 28,559,963 S212P probably benign Het
Anxa10 A G 8: 62,060,245 probably benign Het
Apoa2 A G 1: 171,225,699 probably null Het
Arfgef2 T C 2: 166,826,969 probably benign Het
Arhgap30 G T 1: 171,403,286 V204L probably damaging Het
Cd109 T A 9: 78,688,941 V852E possibly damaging Het
Ceacam5 T A 7: 17,747,344 Y339N probably damaging Het
Chaf1a A G 17: 56,067,441 D876G probably damaging Het
Chd9 A G 8: 90,933,002 K197E possibly damaging Het
Cnr2 A T 4: 135,917,321 M237L probably benign Het
Dnm2 C A 9: 21,505,660 Q830K probably damaging Het
Dst T C 1: 34,271,419 L1615P probably damaging Het
Eid1 A G 2: 125,673,577 D129G probably damaging Het
Exoc5 A G 14: 49,039,342 probably benign Het
Greb1 T C 12: 16,673,802 Y1854C probably benign Het
Il15ra T A 2: 11,718,327 V54E probably damaging Het
Il4i1 G A 7: 44,839,704 V306M probably damaging Het
Lrsam1 T C 2: 32,947,909 D211G probably benign Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Myrfl C T 10: 116,803,394 probably benign Het
Nell1 A G 7: 50,219,585 I203V probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr112 G A 17: 37,563,387 T308I probably benign Het
Olfr1234 T C 2: 89,363,255 Y58C probably damaging Het
Olfr654 T A 7: 104,588,672 N289K probably damaging Het
Pex3 C A 10: 13,542,676 A79S probably benign Het
Pla2r1 A C 2: 60,458,410 L626R possibly damaging Het
Plcb3 A G 19: 6,954,878 S1107P probably damaging Het
Ppcdc C T 9: 57,420,158 probably null Het
Rbak A T 5: 143,173,579 F573Y probably damaging Het
Rfc1 A G 5: 65,278,709 probably null Het
Rpl13 C T 8: 123,105,174 A203V possibly damaging Het
Scn8a A G 15: 101,015,787 H1020R possibly damaging Het
Slf1 A G 13: 77,103,471 probably benign Het
Synj1 A G 16: 90,960,445 L905S possibly damaging Het
Tmem59 T A 4: 107,187,725 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uri1 A T 7: 37,969,678 D127E probably damaging Het
Usp31 T C 7: 121,670,253 E489G probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp941 C T 7: 140,811,664 R594H probably damaging Het
Zfy1 T C Y: 725,983 D594G probably damaging Het
Other mutations in Pdxdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Pdxdc1 APN 16 13859152 missense probably damaging 1.00
IGL02101:Pdxdc1 APN 16 13869856 missense probably damaging 0.99
IGL02484:Pdxdc1 APN 16 13876081 missense possibly damaging 0.94
IGL02523:Pdxdc1 APN 16 13881935 missense probably damaging 1.00
IGL02560:Pdxdc1 APN 16 13839732 missense probably benign 0.00
IGL02884:Pdxdc1 APN 16 13843795 missense possibly damaging 0.86
IGL03008:Pdxdc1 APN 16 13876159 missense possibly damaging 0.81
IGL03162:Pdxdc1 APN 16 13857417 missense probably damaging 0.99
IGL02991:Pdxdc1 UTSW 16 13857396 missense probably damaging 1.00
PIT4472001:Pdxdc1 UTSW 16 13845345 missense probably damaging 1.00
R0015:Pdxdc1 UTSW 16 13887683 splice site probably benign
R0240:Pdxdc1 UTSW 16 13879445 missense probably damaging 1.00
R0240:Pdxdc1 UTSW 16 13879445 missense probably damaging 1.00
R0432:Pdxdc1 UTSW 16 13854400 missense probably damaging 0.97
R0846:Pdxdc1 UTSW 16 13854393 critical splice donor site probably null
R0944:Pdxdc1 UTSW 16 13838369 missense probably damaging 1.00
R1118:Pdxdc1 UTSW 16 13879414 splice site probably benign
R1726:Pdxdc1 UTSW 16 13838300 critical splice donor site probably null
R2425:Pdxdc1 UTSW 16 13879508 missense possibly damaging 0.90
R3890:Pdxdc1 UTSW 16 13836448 missense probably benign
R4452:Pdxdc1 UTSW 16 13837126 missense possibly damaging 0.55
R4516:Pdxdc1 UTSW 16 13838346 nonsense probably null
R4938:Pdxdc1 UTSW 16 13876069 missense probably benign 0.03
R5352:Pdxdc1 UTSW 16 13840311 missense probably benign 0.01
R5554:Pdxdc1 UTSW 16 13872499 missense probably benign 0.01
R7300:Pdxdc1 UTSW 16 13879510 missense probably damaging 0.99
R7356:Pdxdc1 UTSW 16 13860003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTTTCTCACTCTGGACAGAGGAC -3'
(R):5'- TGTGAATCCTCCATGAACACAGCC -3'

Sequencing Primer
(F):5'- CTCTGGACAGAGGACATCAAAAG -3'
(R):5'- AGCCAGCTCTTTGAGCTAAG -3'
Posted On2013-11-08