Incidental Mutation 'R0946:Top1'
ID82088
Institutional Source Beutler Lab
Gene Symbol Top1
Ensembl Gene ENSMUSG00000070544
Gene Nametopoisomerase (DNA) I
SynonymsD130064I21Rik, Top-1
MMRRC Submission 039085-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0946 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160645888-160722764 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 160712668 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 446 (Y446*)
Ref Sequence ENSEMBL: ENSMUSP00000105094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109468]
Predicted Effect probably null
Transcript: ENSMUST00000109468
AA Change: Y446*
SMART Domains Protein: ENSMUSP00000105094
Gene: ENSMUSG00000070544
AA Change: Y446*

DomainStartEndE-ValueType
low complexity region 20 95 N/A INTRINSIC
low complexity region 150 211 N/A INTRINSIC
Blast:TOPEUc 245 321 9e-19 BLAST
low complexity region 323 339 N/A INTRINSIC
TOPEUc 362 739 4.43e-280 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150039
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous mutation resulted in early embryonic lethality at the 4 to 16 cell stage of development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,165,696 N122K possibly damaging Het
9230112D13Rik A G 14: 34,512,142 M64T unknown Het
Adamts15 C T 9: 30,902,197 G891R probably damaging Het
Adck5 G A 15: 76,593,286 V107I possibly damaging Het
Aoc3 G A 11: 101,332,305 V456M possibly damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Camsap3 A G 8: 3,604,442 H693R probably benign Het
Ccdc88a A G 11: 29,456,509 T414A probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Coasy G T 11: 101,085,870 V489F probably damaging Het
Ercc6 A T 14: 32,552,621 M574L probably benign Het
Esrrb T C 12: 86,505,824 L180P probably damaging Het
Fam83b A T 9: 76,491,397 V808D probably damaging Het
Fat3 C T 9: 15,997,804 V2301I possibly damaging Het
Gm813 C A 16: 58,614,712 R83S probably damaging Het
Gm9573 A C 17: 35,618,213 S1581A probably benign Het
Hyal4 T A 6: 24,755,913 Y43* probably null Het
Hydin C A 8: 110,531,053 L2372M probably benign Het
Lrrc4c T C 2: 97,629,464 V145A probably benign Het
Myh4 A G 11: 67,251,751 I913V possibly damaging Het
Nat10 C T 2: 103,731,374 G654D probably damaging Het
Nbn A T 4: 15,970,719 probably null Het
Oas3 T C 5: 120,769,063 Y503C unknown Het
Olfr740 C A 14: 50,453,673 T207K probably benign Het
Pappa G T 4: 65,314,792 probably null Het
Pfas A G 11: 68,993,295 probably null Het
Pfas G T 11: 68,990,747 probably null Het
Pign A T 1: 105,591,697 M500K probably benign Het
Pkhd1 T C 1: 20,199,381 K3313R probably benign Het
Ptk2b A G 14: 66,158,598 V807A probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Rfpl4b A T 10: 38,820,837 I256N probably benign Het
Skap1 C G 11: 96,541,469 S88* probably null Het
Slc4a2 T C 5: 24,435,886 S742P probably damaging Het
Supv3l1 T C 10: 62,429,820 D647G probably damaging Het
Tmem184c A C 8: 77,604,757 V121G probably damaging Het
Tonsl T C 15: 76,623,221 I118V probably benign Het
Trim37 A G 11: 87,146,955 R172G probably damaging Het
Vgll4 C A 6: 114,890,807 probably null Het
Vgll4 T A 6: 114,890,808 probably null Het
Vmn1r5 T G 6: 56,986,165 I275S possibly damaging Het
Vwde A T 6: 13,187,875 H584Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp282 T A 6: 47,880,009 W59R probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zswim2 T A 2: 83,923,759 T186S probably benign Het
Other mutations in Top1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Top1 APN 2 160704973 splice site probably null
IGL03083:Top1 APN 2 160703578 missense probably damaging 0.97
IGL03242:Top1 APN 2 160715733 missense probably damaging 1.00
IGL03369:Top1 APN 2 160693727 missense unknown
R0022:Top1 UTSW 2 160702799 missense possibly damaging 0.62
R0449:Top1 UTSW 2 160712708 nonsense probably null
R0501:Top1 UTSW 2 160714159 missense probably damaging 1.00
R0564:Top1 UTSW 2 160714265 missense probably damaging 0.98
R0972:Top1 UTSW 2 160721025 missense probably damaging 1.00
R0976:Top1 UTSW 2 160717423 missense possibly damaging 0.86
R1534:Top1 UTSW 2 160714232 missense probably damaging 1.00
R1608:Top1 UTSW 2 160703595 missense probably benign 0.01
R1655:Top1 UTSW 2 160703696 critical splice donor site probably null
R1818:Top1 UTSW 2 160715723 missense probably damaging 1.00
R1937:Top1 UTSW 2 160670122 missense unknown
R2055:Top1 UTSW 2 160702828 splice site probably benign
R2104:Top1 UTSW 2 160704819 missense probably damaging 1.00
R3705:Top1 UTSW 2 160702824 critical splice donor site probably null
R3769:Top1 UTSW 2 160721522 missense probably damaging 1.00
R3770:Top1 UTSW 2 160721522 missense probably damaging 1.00
R3801:Top1 UTSW 2 160702768 missense probably damaging 1.00
R3804:Top1 UTSW 2 160702768 missense probably damaging 1.00
R3928:Top1 UTSW 2 160687749 splice site probably benign
R4598:Top1 UTSW 2 160720965 missense possibly damaging 0.89
R4651:Top1 UTSW 2 160712717 missense probably damaging 1.00
R4652:Top1 UTSW 2 160712717 missense probably damaging 1.00
R4742:Top1 UTSW 2 160703570 critical splice acceptor site probably null
R5523:Top1 UTSW 2 160702775 nonsense probably null
R6292:Top1 UTSW 2 160698141 missense probably benign 0.19
R6724:Top1 UTSW 2 160712696 missense probably damaging 1.00
R7354:Top1 UTSW 2 160704958 missense probably damaging 1.00
R7461:Top1 UTSW 2 160712842 splice site probably null
R7843:Top1 UTSW 2 160714256 missense possibly damaging 0.90
R7855:Top1 UTSW 2 160714088 missense probably damaging 1.00
R8100:Top1 UTSW 2 160698235 nonsense probably null
R8302:Top1 UTSW 2 160703576 missense probably damaging 1.00
R8377:Top1 UTSW 2 160646089 start gained probably benign
R8380:Top1 UTSW 2 160717395 missense probably benign 0.00
R8381:Top1 UTSW 2 160703674 missense probably null 0.77
R8392:Top1 UTSW 2 160717454 nonsense probably null
X0027:Top1 UTSW 2 160721518 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTGGATCTCACAAGAGTGGGAAC -3'
(R):5'- AGCCAACATACTGTACATGCCTCTTTC -3'

Sequencing Primer
(F):5'- CTTAGCAATTATACAGGACGGAGTC -3'
(R):5'- GTCACACAGCAGATATACATTCCTG -3'
Posted On2013-11-08