Incidental Mutation 'R0946:Oas3'
ID 82093
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name 2'-5' oligoadenylate synthetase 3
Synonyms Oasl10, 2'-5' oligoadenylate synthetase-like 10
MMRRC Submission 039085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R0946 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 120753098-120777661 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120769063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 503 (Y503C)
Ref Sequence ENSEMBL: ENSMUSP00000035588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833]
AlphaFold Q8VI93
Predicted Effect unknown
Transcript: ENSMUST00000044833
AA Change: Y503C
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: Y503C

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166703
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,165,696 N122K possibly damaging Het
9230112D13Rik A G 14: 34,512,142 M64T unknown Het
Adamts15 C T 9: 30,902,197 G891R probably damaging Het
Adck5 G A 15: 76,593,286 V107I possibly damaging Het
Aoc3 G A 11: 101,332,305 V456M possibly damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Camsap3 A G 8: 3,604,442 H693R probably benign Het
Ccdc88a A G 11: 29,456,509 T414A probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Coasy G T 11: 101,085,870 V489F probably damaging Het
Ercc6 A T 14: 32,552,621 M574L probably benign Het
Esrrb T C 12: 86,505,824 L180P probably damaging Het
Fam83b A T 9: 76,491,397 V808D probably damaging Het
Fat3 C T 9: 15,997,804 V2301I possibly damaging Het
Gm813 C A 16: 58,614,712 R83S probably damaging Het
Gm9573 A C 17: 35,618,213 S1581A probably benign Het
Hyal4 T A 6: 24,755,913 Y43* probably null Het
Hydin C A 8: 110,531,053 L2372M probably benign Het
Lrrc4c T C 2: 97,629,464 V145A probably benign Het
Myh4 A G 11: 67,251,751 I913V possibly damaging Het
Nat10 C T 2: 103,731,374 G654D probably damaging Het
Nbn A T 4: 15,970,719 probably null Het
Olfr740 C A 14: 50,453,673 T207K probably benign Het
Pappa G T 4: 65,314,792 probably null Het
Pfas A G 11: 68,993,295 probably null Het
Pfas G T 11: 68,990,747 probably null Het
Pign A T 1: 105,591,697 M500K probably benign Het
Pkhd1 T C 1: 20,199,381 K3313R probably benign Het
Ptk2b A G 14: 66,158,598 V807A probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Rfpl4b A T 10: 38,820,837 I256N probably benign Het
Skap1 C G 11: 96,541,469 S88* probably null Het
Slc4a2 T C 5: 24,435,886 S742P probably damaging Het
Supv3l1 T C 10: 62,429,820 D647G probably damaging Het
Tmem184c A C 8: 77,604,757 V121G probably damaging Het
Tonsl T C 15: 76,623,221 I118V probably benign Het
Top1 T A 2: 160,712,668 Y446* probably null Het
Trim37 A G 11: 87,146,955 R172G probably damaging Het
Vgll4 C A 6: 114,890,807 probably null Het
Vgll4 T A 6: 114,890,808 probably null Het
Vmn1r5 T G 6: 56,986,165 I275S possibly damaging Het
Vwde A T 6: 13,187,875 H584Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp282 T A 6: 47,880,009 W59R probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zswim2 T A 2: 83,923,759 T186S probably benign Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
R8022:Oas3 UTSW 5 120756966 missense possibly damaging 0.91
R8137:Oas3 UTSW 5 120777500 missense probably benign 0.07
R8967:Oas3 UTSW 5 120758842 missense probably damaging 0.99
R9124:Oas3 UTSW 5 120774105 missense probably damaging 1.00
R9287:Oas3 UTSW 5 120754689 missense probably damaging 1.00
RF006:Oas3 UTSW 5 120774100 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGTCTATACCCAGCCAGCAAGCC -3'
(R):5'- TCCAGGATTTCCAGAAGCAGCCAC -3'

Sequencing Primer
(F):5'- GCCAGCAAGCCACACTTC -3'
(R):5'- AGTCATGTTCGGATCACCCAG -3'
Posted On 2013-11-08