Incidental Mutation 'R0946:1700123L14Rik'
ID 82098
Institutional Source Beutler Lab
Gene Symbol 1700123L14Rik
Ensembl Gene ENSMUSG00000072878
Gene Name RIKEN cDNA 1700123L14 gene
Synonyms
MMRRC Submission 039085-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock # R0946 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 96164497-96166243 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 96165696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 122 (N122K)
Ref Sequence ENSEMBL: ENSMUSP00000087515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075080] [ENSMUST00000090061] [ENSMUST00000122120]
AlphaFold Q3V2K7
Predicted Effect probably benign
Transcript: ENSMUST00000075080
SMART Domains Protein: ENSMUSP00000074589
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 40 129 3.9e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090061
AA Change: N122K

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087515
Gene: ENSMUSG00000072878
AA Change: N122K

DomainStartEndE-ValueType
Pfam:NUP50 2 73 1.8e-15 PFAM
low complexity region 84 94 N/A INTRINSIC
RanBD 315 438 2.69e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122120
SMART Domains Protein: ENSMUSP00000113152
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 41 129 4e-50 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik A G 14: 34,512,142 M64T unknown Het
Adamts15 C T 9: 30,902,197 G891R probably damaging Het
Adck5 G A 15: 76,593,286 V107I possibly damaging Het
Aoc3 G A 11: 101,332,305 V456M possibly damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Camsap3 A G 8: 3,604,442 H693R probably benign Het
Ccdc88a A G 11: 29,456,509 T414A probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Coasy G T 11: 101,085,870 V489F probably damaging Het
Ercc6 A T 14: 32,552,621 M574L probably benign Het
Esrrb T C 12: 86,505,824 L180P probably damaging Het
Fam83b A T 9: 76,491,397 V808D probably damaging Het
Fat3 C T 9: 15,997,804 V2301I possibly damaging Het
Gm813 C A 16: 58,614,712 R83S probably damaging Het
Gm9573 A C 17: 35,618,213 S1581A probably benign Het
Hyal4 T A 6: 24,755,913 Y43* probably null Het
Hydin C A 8: 110,531,053 L2372M probably benign Het
Lrrc4c T C 2: 97,629,464 V145A probably benign Het
Myh4 A G 11: 67,251,751 I913V possibly damaging Het
Nat10 C T 2: 103,731,374 G654D probably damaging Het
Nbn A T 4: 15,970,719 probably null Het
Oas3 T C 5: 120,769,063 Y503C unknown Het
Olfr740 C A 14: 50,453,673 T207K probably benign Het
Pappa G T 4: 65,314,792 probably null Het
Pfas A G 11: 68,993,295 probably null Het
Pfas G T 11: 68,990,747 probably null Het
Pign A T 1: 105,591,697 M500K probably benign Het
Pkhd1 T C 1: 20,199,381 K3313R probably benign Het
Ptk2b A G 14: 66,158,598 V807A probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Rfpl4b A T 10: 38,820,837 I256N probably benign Het
Skap1 C G 11: 96,541,469 S88* probably null Het
Slc4a2 T C 5: 24,435,886 S742P probably damaging Het
Supv3l1 T C 10: 62,429,820 D647G probably damaging Het
Tmem184c A C 8: 77,604,757 V121G probably damaging Het
Tonsl T C 15: 76,623,221 I118V probably benign Het
Top1 T A 2: 160,712,668 Y446* probably null Het
Trim37 A G 11: 87,146,955 R172G probably damaging Het
Vgll4 C A 6: 114,890,807 probably null Het
Vgll4 T A 6: 114,890,808 probably null Het
Vmn1r5 T G 6: 56,986,165 I275S possibly damaging Het
Vwde A T 6: 13,187,875 H584Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp282 T A 6: 47,880,009 W59R probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zswim2 T A 2: 83,923,759 T186S probably benign Het
Other mutations in 1700123L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:1700123L14Rik APN 6 96165694 missense possibly damaging 0.48
IGL02347:1700123L14Rik APN 6 96165530 missense probably damaging 1.00
IGL02532:1700123L14Rik APN 6 96164790 missense probably damaging 0.99
PIT4283001:1700123L14Rik UTSW 6 96165715 missense probably benign
R0282:1700123L14Rik UTSW 6 96164816 missense probably benign 0.02
R1275:1700123L14Rik UTSW 6 96165118 missense probably benign 0.03
R1605:1700123L14Rik UTSW 6 96164812 missense probably benign 0.34
R1610:1700123L14Rik UTSW 6 96165289 missense probably damaging 0.98
R1959:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R1961:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R2116:1700123L14Rik UTSW 6 96164860 missense probably damaging 0.99
R3708:1700123L14Rik UTSW 6 96165952 missense possibly damaging 0.92
R4157:1700123L14Rik UTSW 6 96165283 missense possibly damaging 0.86
R4285:1700123L14Rik UTSW 6 96165752 missense probably benign 0.07
R4571:1700123L14Rik UTSW 6 96164881 missense probably damaging 1.00
R4884:1700123L14Rik UTSW 6 96164812 missense probably damaging 1.00
R4905:1700123L14Rik UTSW 6 96165930 missense possibly damaging 0.77
R6454:1700123L14Rik UTSW 6 96165628 missense possibly damaging 0.75
R6755:1700123L14Rik UTSW 6 96164972 missense probably benign 0.06
R6790:1700123L14Rik UTSW 6 96165323 missense probably benign
R6792:1700123L14Rik UTSW 6 96165115 missense possibly damaging 0.92
R6931:1700123L14Rik UTSW 6 96165548 missense possibly damaging 0.86
R7081:1700123L14Rik UTSW 6 96165817 missense possibly damaging 0.68
R7194:1700123L14Rik UTSW 6 96164775 missense probably benign 0.04
R7584:1700123L14Rik UTSW 6 96165392 missense probably benign 0.41
R7938:1700123L14Rik UTSW 6 96164885 missense possibly damaging 0.66
R7983:1700123L14Rik UTSW 6 96165907 missense probably damaging 0.96
R8052:1700123L14Rik UTSW 6 96165097 intron probably benign
R8052:1700123L14Rik UTSW 6 96165103 intron probably benign
R8303:1700123L14Rik UTSW 6 96165721 missense probably benign 0.41
R8351:1700123L14Rik UTSW 6 96165674 missense probably benign 0.12
R8785:1700123L14Rik UTSW 6 96164890 missense possibly damaging 0.87
R8827:1700123L14Rik UTSW 6 96165312 missense probably benign 0.00
R9280:1700123L14Rik UTSW 6 96165001 missense probably damaging 1.00
R9403:1700123L14Rik UTSW 6 96165299 missense probably benign 0.01
R9470:1700123L14Rik UTSW 6 96165493 missense possibly damaging 0.56
R9600:1700123L14Rik UTSW 6 96165175 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CTGTAGTTCAGTGGCAACAGCTAGG -3'
(R):5'- CCAATGGTAAGGGGACTTCCAAAGG -3'

Sequencing Primer
(F):5'- CGATGGCAGCCAAGTATTTC -3'
(R):5'- AAAAGTTTGGCTGTGCCTTCC -3'
Posted On 2013-11-08