Incidental Mutation 'R0946:Rfpl4b'
ID82111
Institutional Source Beutler Lab
Gene Symbol Rfpl4b
Ensembl Gene ENSMUSG00000094311
Gene Nameret finger protein-like 4B
SynonymsGm3037, Gm62, LOC215919
MMRRC Submission 039085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0946 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location38820541-38821779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38820837 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 256 (I256N)
Ref Sequence ENSEMBL: ENSMUSP00000137446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179279]
Predicted Effect probably benign
Transcript: ENSMUST00000179279
AA Change: I256N

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137446
Gene: ENSMUSG00000094311
AA Change: I256N

DomainStartEndE-ValueType
RING 31 72 1.86e-4 SMART
Blast:PRY 115 163 2e-8 BLAST
PDB:2FBE|D 132 242 3e-7 PDB
Blast:SPRY 168 266 4e-12 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,165,696 N122K possibly damaging Het
9230112D13Rik A G 14: 34,512,142 M64T unknown Het
Adamts15 C T 9: 30,902,197 G891R probably damaging Het
Adck5 G A 15: 76,593,286 V107I possibly damaging Het
Aoc3 G A 11: 101,332,305 V456M possibly damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Camsap3 A G 8: 3,604,442 H693R probably benign Het
Ccdc88a A G 11: 29,456,509 T414A probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Coasy G T 11: 101,085,870 V489F probably damaging Het
Ercc6 A T 14: 32,552,621 M574L probably benign Het
Esrrb T C 12: 86,505,824 L180P probably damaging Het
Fam83b A T 9: 76,491,397 V808D probably damaging Het
Fat3 C T 9: 15,997,804 V2301I possibly damaging Het
Gm813 C A 16: 58,614,712 R83S probably damaging Het
Gm9573 A C 17: 35,618,213 S1581A probably benign Het
Hyal4 T A 6: 24,755,913 Y43* probably null Het
Hydin C A 8: 110,531,053 L2372M probably benign Het
Lrrc4c T C 2: 97,629,464 V145A probably benign Het
Myh4 A G 11: 67,251,751 I913V possibly damaging Het
Nat10 C T 2: 103,731,374 G654D probably damaging Het
Nbn A T 4: 15,970,719 probably null Het
Oas3 T C 5: 120,769,063 Y503C unknown Het
Olfr740 C A 14: 50,453,673 T207K probably benign Het
Pappa G T 4: 65,314,792 probably null Het
Pfas A G 11: 68,993,295 probably null Het
Pfas G T 11: 68,990,747 probably null Het
Pign A T 1: 105,591,697 M500K probably benign Het
Pkhd1 T C 1: 20,199,381 K3313R probably benign Het
Ptk2b A G 14: 66,158,598 V807A probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Skap1 C G 11: 96,541,469 S88* probably null Het
Slc4a2 T C 5: 24,435,886 S742P probably damaging Het
Supv3l1 T C 10: 62,429,820 D647G probably damaging Het
Tmem184c A C 8: 77,604,757 V121G probably damaging Het
Tonsl T C 15: 76,623,221 I118V probably benign Het
Top1 T A 2: 160,712,668 Y446* probably null Het
Trim37 A G 11: 87,146,955 R172G probably damaging Het
Vgll4 C A 6: 114,890,807 probably null Het
Vgll4 T A 6: 114,890,808 probably null Het
Vmn1r5 T G 6: 56,986,165 I275S possibly damaging Het
Vwde A T 6: 13,187,875 H584Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp282 T A 6: 47,880,009 W59R probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zswim2 T A 2: 83,923,759 T186S probably benign Het
Other mutations in Rfpl4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Rfpl4b UTSW 10 38821350 missense possibly damaging 0.85
BB019:Rfpl4b UTSW 10 38821350 missense possibly damaging 0.85
R1628:Rfpl4b UTSW 10 38821534 missense probably benign
R1746:Rfpl4b UTSW 10 38821053 missense possibly damaging 0.96
R2419:Rfpl4b UTSW 10 38821372 missense probably benign 0.03
R5466:Rfpl4b UTSW 10 38821398 missense probably damaging 0.98
R5613:Rfpl4b UTSW 10 38821377 missense probably benign 0.00
R5699:Rfpl4b UTSW 10 38821285 missense possibly damaging 0.86
R6401:Rfpl4b UTSW 10 38820945 missense possibly damaging 0.53
R6799:Rfpl4b UTSW 10 38821345 missense possibly damaging 0.61
R7932:Rfpl4b UTSW 10 38821350 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGTCCTCCAATCTTGCTCTGAAAGG -3'
(R):5'- CAGTCTGCCACTGGGAAGTTGATG -3'

Sequencing Primer
(F):5'- CTTGCTCTGAAAGGAAGATTAAAAAC -3'
(R):5'- CAGGAGGAACATCTATTTACTCCG -3'
Posted On2013-11-08