Incidental Mutation 'R0946:Skap1'
ID82119
Institutional Source Beutler Lab
Gene Symbol Skap1
Ensembl Gene ENSMUSG00000057058
Gene Namesrc family associated phosphoprotein 1
SynonymsSkap-55, 1700091G21Rik
MMRRC Submission 039085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R0946 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location96464593-96759130 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to G at 96541469 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 88 (S88*)
Ref Sequence ENSEMBL: ENSMUSP00000103290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071510] [ENSMUST00000100521] [ENSMUST00000103154] [ENSMUST00000107662] [ENSMUST00000107663]
Predicted Effect probably null
Transcript: ENSMUST00000071510
AA Change: S88*
SMART Domains Protein: ENSMUSP00000071445
Gene: ENSMUSG00000057058
AA Change: S88*

DomainStartEndE-ValueType
low complexity region 59 74 N/A INTRINSIC
PH 108 212 1.46e-24 SMART
low complexity region 220 235 N/A INTRINSIC
SH3 277 334 2.56e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100521
AA Change: S88*
SMART Domains Protein: ENSMUSP00000098090
Gene: ENSMUSG00000057058
AA Change: S88*

DomainStartEndE-ValueType
low complexity region 59 74 N/A INTRINSIC
PH 108 212 1.46e-24 SMART
low complexity region 220 235 N/A INTRINSIC
SH3 277 314 2.64e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103154
AA Change: S88*
SMART Domains Protein: ENSMUSP00000099443
Gene: ENSMUSG00000057058
AA Change: S88*

DomainStartEndE-ValueType
low complexity region 59 74 N/A INTRINSIC
PH 108 212 1.46e-24 SMART
low complexity region 220 235 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
SH3 293 350 2.56e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107662
AA Change: S88*
SMART Domains Protein: ENSMUSP00000103289
Gene: ENSMUSG00000057058
AA Change: S88*

DomainStartEndE-ValueType
Blast:PH 40 114 5e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000107663
AA Change: S88*
SMART Domains Protein: ENSMUSP00000103290
Gene: ENSMUSG00000057058
AA Change: S88*

DomainStartEndE-ValueType
PDB:2OTX|B 7 57 1e-6 PDB
Blast:PH 40 94 7e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136836
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a T cell adaptor protein, a class of intracellular molecules with modular domains capable of recruiting additional proteins but that exhibit no intrinsic enzymatic activity. The encoded protein contains a unique N-terminal region followed by a PH domain and C-terminal SH3 domain. Along with the adhesion and degranulation-promoting adaptor protein, the encoded protein plays a critical role in inside-out signaling by coupling T-cell antigen receptor stimulation to the activation of integrins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased T cell aggregation, adhesion and proliferation following stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,165,696 N122K possibly damaging Het
9230112D13Rik A G 14: 34,512,142 M64T unknown Het
Adamts15 C T 9: 30,902,197 G891R probably damaging Het
Adck5 G A 15: 76,593,286 V107I possibly damaging Het
Aoc3 G A 11: 101,332,305 V456M possibly damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Camsap3 A G 8: 3,604,442 H693R probably benign Het
Ccdc88a A G 11: 29,456,509 T414A probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Coasy G T 11: 101,085,870 V489F probably damaging Het
Ercc6 A T 14: 32,552,621 M574L probably benign Het
Esrrb T C 12: 86,505,824 L180P probably damaging Het
Fam83b A T 9: 76,491,397 V808D probably damaging Het
Fat3 C T 9: 15,997,804 V2301I possibly damaging Het
Gm813 C A 16: 58,614,712 R83S probably damaging Het
Gm9573 A C 17: 35,618,213 S1581A probably benign Het
Hyal4 T A 6: 24,755,913 Y43* probably null Het
Hydin C A 8: 110,531,053 L2372M probably benign Het
Lrrc4c T C 2: 97,629,464 V145A probably benign Het
Myh4 A G 11: 67,251,751 I913V possibly damaging Het
Nat10 C T 2: 103,731,374 G654D probably damaging Het
Nbn A T 4: 15,970,719 probably null Het
Oas3 T C 5: 120,769,063 Y503C unknown Het
Olfr740 C A 14: 50,453,673 T207K probably benign Het
Pappa G T 4: 65,314,792 probably null Het
Pfas A G 11: 68,993,295 probably null Het
Pfas G T 11: 68,990,747 probably null Het
Pign A T 1: 105,591,697 M500K probably benign Het
Pkhd1 T C 1: 20,199,381 K3313R probably benign Het
Ptk2b A G 14: 66,158,598 V807A probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Rfpl4b A T 10: 38,820,837 I256N probably benign Het
Slc4a2 T C 5: 24,435,886 S742P probably damaging Het
Supv3l1 T C 10: 62,429,820 D647G probably damaging Het
Tmem184c A C 8: 77,604,757 V121G probably damaging Het
Tonsl T C 15: 76,623,221 I118V probably benign Het
Top1 T A 2: 160,712,668 Y446* probably null Het
Trim37 A G 11: 87,146,955 R172G probably damaging Het
Vgll4 C A 6: 114,890,807 probably null Het
Vgll4 T A 6: 114,890,808 probably null Het
Vmn1r5 T G 6: 56,986,165 I275S possibly damaging Het
Vwde A T 6: 13,187,875 H584Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp282 T A 6: 47,880,009 W59R probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zswim2 T A 2: 83,923,759 T186S probably benign Het
Other mutations in Skap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Skap1 APN 11 96489910 missense probably damaging 1.00
IGL00565:Skap1 APN 11 96731145 missense probably damaging 1.00
IGL00565:Skap1 APN 11 96731190 missense probably damaging 1.00
IGL02351:Skap1 APN 11 96708556 splice site probably null
IGL02474:Skap1 APN 11 96708686 missense probably damaging 0.98
IGL02797:Skap1 APN 11 96713017 missense possibly damaging 0.78
IGL03025:Skap1 APN 11 96702682 missense probably damaging 1.00
IGL03115:Skap1 APN 11 96702620 missense probably benign 0.00
R0601:Skap1 UTSW 11 96723410 splice site probably benign
R0741:Skap1 UTSW 11 96492933 intron probably benign
R2051:Skap1 UTSW 11 96541463 missense possibly damaging 0.89
R2132:Skap1 UTSW 11 96464733 missense possibly damaging 0.95
R4130:Skap1 UTSW 11 96526045 missense probably damaging 1.00
R4923:Skap1 UTSW 11 96754044 missense probably damaging 1.00
R5893:Skap1 UTSW 11 96581398 makesense probably null
R6207:Skap1 UTSW 11 96704133 nonsense probably null
R6577:Skap1 UTSW 11 96526044 missense probably damaging 1.00
R7158:Skap1 UTSW 11 96526057 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTCGCACACAGGTAAGGTAAGTTGG -3'
(R):5'- CCACAGCAAAGCAAGTAGGTGCTC -3'

Sequencing Primer
(F):5'- ATCAAGTAAGGGATGCTGCTGTC -3'
(R):5'- AAGTAGGTGCTCTTTGCCCAC -3'
Posted On2013-11-08