Incidental Mutation 'R0862:Adamts13'
ID82139
Institutional Source Beutler Lab
Gene Symbol Adamts13
Ensembl Gene ENSMUSG00000014852
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
SynonymsvWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
MMRRC Submission 039036-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0862 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26973416-27009628 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 27006324 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102891] [ENSMUST00000114003] [ENSMUST00000114004] [ENSMUST00000114005] [ENSMUST00000114006] [ENSMUST00000114007]
Predicted Effect probably null
Transcript: ENSMUST00000102891
SMART Domains Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 8.5e-11 PFAM
Pfam:Reprolysin 96 291 4.9e-14 PFAM
Pfam:Reprolysin_3 106 237 5.6e-11 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Blast:TSP1 1022 1079 4e-26 BLAST
TSP1 1081 1137 4.58e-4 SMART
Blast:CUB 1196 1293 2e-39 BLAST
Blast:CUB 1303 1412 3e-63 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114003
SMART Domains Protein: ENSMUSP00000109636
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
Cg6151-P 1 80 6.19e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114004
SMART Domains Protein: ENSMUSP00000109637
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 106 7.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114005
SMART Domains Protein: ENSMUSP00000109638
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 114 5.53e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114006
SMART Domains Protein: ENSMUSP00000109639
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114007
SMART Domains Protein: ENSMUSP00000109640
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133126
Predicted Effect probably benign
Transcript: ENSMUST00000133807
SMART Domains Protein: ENSMUSP00000122562
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
Cg6151-P 53 118 8.02e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147216
Meta Mutation Damage Score 0.9572 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 94.9%
  • 20x: 87.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9230009I02Rik T C 11: 51,091,317 noncoding transcript Het
Chac1 C A 2: 119,353,469 A184E probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Csmd1 T A 8: 16,190,026 Y1124F probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Dyrk4 T C 6: 126,877,333 E499G possibly damaging Het
Fat1 T A 8: 45,018,037 I1603N probably damaging Het
Fbn1 A T 2: 125,342,891 C1660* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gm19684 A T 17: 36,121,900 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Map4 A G 9: 109,978,969 Y34C probably damaging Het
Mapk8 C T 14: 33,392,992 R189H probably damaging Het
Mgst1 C T 6: 138,147,751 T21M probably damaging Het
Msh2 A G 17: 87,680,052 T207A probably benign Het
Mthfd2 A G 6: 83,313,394 V85A probably damaging Het
Muc4 A G 16: 32,752,002 S627G probably benign Het
Nbeal2 G A 9: 110,628,195 T2266I probably damaging Het
Olfr26 T C 9: 38,855,182 V40A possibly damaging Het
Olfr623 T C 7: 103,660,528 T241A probably damaging Het
Olfr828 T C 9: 18,815,706 Y196C probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd6ip A T 9: 113,674,510 probably benign Het
Piwil2 T C 14: 70,395,374 D583G probably benign Het
Plin4 T A 17: 56,103,966 M1022L probably benign Het
Rbm48 A G 5: 3,590,438 S314P probably benign Het
Rbms3 A T 9: 117,629,792 probably benign Het
Snx14 A T 9: 88,383,996 S726T possibly damaging Het
Trim43c A T 9: 88,843,034 H202L probably benign Het
Trip12 A G 1: 84,744,009 F1334S probably damaging Het
Tyk2 T C 9: 21,116,167 H503R probably benign Het
Ubr2 G A 17: 46,967,083 Q745* probably null Het
Ush2a T A 1: 188,542,818 Y1829* probably null Het
Vmn2r65 T A 7: 84,943,645 E451D probably benign Het
Other mutations in Adamts13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adamts13 APN 2 27005361 missense probably benign 0.04
IGL00465:Adamts13 APN 2 26973555 missense probably benign 0.32
IGL01114:Adamts13 APN 2 27005190 missense probably benign 0.41
IGL01138:Adamts13 APN 2 26983042 missense probably damaging 1.00
IGL01154:Adamts13 APN 2 27006194 missense probably benign
IGL01860:Adamts13 APN 2 26978011 missense probably damaging 0.99
IGL01924:Adamts13 APN 2 26996583 missense possibly damaging 0.80
IGL01991:Adamts13 APN 2 26990598 missense probably damaging 0.97
IGL02215:Adamts13 APN 2 26985483 missense probably damaging 1.00
IGL02415:Adamts13 APN 2 26989283 missense possibly damaging 0.95
IGL02519:Adamts13 APN 2 26978675 missense probably damaging 1.00
IGL02956:Adamts13 APN 2 26983037 missense probably benign 0.18
IGL03209:Adamts13 APN 2 26992961 missense probably benign 0.00
I1329:Adamts13 UTSW 2 26973619 missense possibly damaging 0.52
IGL02837:Adamts13 UTSW 2 26991420 missense probably benign 0.01
IGL03048:Adamts13 UTSW 2 26978699 critical splice donor site probably null
R0041:Adamts13 UTSW 2 26983974 missense probably damaging 1.00
R0217:Adamts13 UTSW 2 26996921 splice site probably benign
R0276:Adamts13 UTSW 2 26975760 missense possibly damaging 0.91
R0309:Adamts13 UTSW 2 26986989 missense probably damaging 0.99
R0348:Adamts13 UTSW 2 26981080 missense probably benign 0.13
R0369:Adamts13 UTSW 2 27005186 missense probably benign 0.00
R0386:Adamts13 UTSW 2 26986679 splice site probably null
R0553:Adamts13 UTSW 2 26991334 nonsense probably null
R0714:Adamts13 UTSW 2 26986985 splice site probably benign
R1320:Adamts13 UTSW 2 26989246 missense probably damaging 0.97
R1458:Adamts13 UTSW 2 26988354 missense probably damaging 1.00
R1473:Adamts13 UTSW 2 26981753 nonsense probably null
R1491:Adamts13 UTSW 2 26978315 missense probably damaging 1.00
R1588:Adamts13 UTSW 2 26975675 missense probably benign 0.01
R1638:Adamts13 UTSW 2 26996583 missense possibly damaging 0.80
R1724:Adamts13 UTSW 2 26991294 missense probably benign 0.00
R1924:Adamts13 UTSW 2 26984141 missense probably damaging 1.00
R2001:Adamts13 UTSW 2 26973990 missense probably benign
R2072:Adamts13 UTSW 2 27005425 missense probably benign 0.10
R2073:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R2409:Adamts13 UTSW 2 26978362 missense probably benign 0.00
R4362:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4363:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4422:Adamts13 UTSW 2 27005400 missense probably benign 0.00
R4769:Adamts13 UTSW 2 27008711 nonsense probably null
R4785:Adamts13 UTSW 2 26983042 missense probably damaging 1.00
R4831:Adamts13 UTSW 2 26983130 critical splice donor site probably null
R4832:Adamts13 UTSW 2 26989402 missense probably benign 0.22
R4945:Adamts13 UTSW 2 26986610 missense probably damaging 1.00
R5047:Adamts13 UTSW 2 26996910 missense probably damaging 0.98
R5126:Adamts13 UTSW 2 26996915 critical splice donor site probably null
R5161:Adamts13 UTSW 2 26993008 missense probably benign 0.00
R5394:Adamts13 UTSW 2 26986558 missense probably benign 0.00
R5557:Adamts13 UTSW 2 26973639 missense probably benign 0.05
R5660:Adamts13 UTSW 2 26996749 missense probably benign
R5890:Adamts13 UTSW 2 26986591 missense probably damaging 0.96
R6168:Adamts13 UTSW 2 27004886 missense probably benign 0.37
R6536:Adamts13 UTSW 2 26975750 missense probably damaging 0.99
R6929:Adamts13 UTSW 2 27006263 nonsense probably null
R7207:Adamts13 UTSW 2 26978695 missense probably damaging 1.00
R7211:Adamts13 UTSW 2 26989298 missense probably benign 0.40
R7212:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R7392:Adamts13 UTSW 2 26989324 missense probably damaging 1.00
R7583:Adamts13 UTSW 2 26973953 missense probably benign
R7604:Adamts13 UTSW 2 27005206 missense probably benign 0.00
R7783:Adamts13 UTSW 2 26990585 missense not run
R7814:Adamts13 UTSW 2 26996549 missense probably benign
R8076:Adamts13 UTSW 2 26990612 missense probably benign 0.06
R8245:Adamts13 UTSW 2 26990556 missense probably damaging 1.00
X0027:Adamts13 UTSW 2 26985546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTCAGGTCCATGCAATCCAAAG -3'
(R):5'- TGACAAAGTAGGAGGCACGTCACC -3'

Sequencing Primer
(F):5'- GACTATTGCTGTGACATACAGCC -3'
(R):5'- aggcacgtcaccagagc -3'
Posted On2013-11-08