Incidental Mutation 'R0862:Olfr26'
ID82155
Institutional Source Beutler Lab
Gene Symbol Olfr26
Ensembl Gene ENSMUSG00000047667
Gene Nameolfactory receptor 26
SynonymsMTPCR09, MOR171-9, GA_x6K02T2PVTD-32550930-32551856
MMRRC Submission 039036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0862 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38855060-38855990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38855182 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 40 (V40A)
Ref Sequence ENSEMBL: ENSMUSP00000100467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104874] [ENSMUST00000217350]
Predicted Effect possibly damaging
Transcript: ENSMUST00000104874
AA Change: V40A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100467
Gene: ENSMUSG00000047667
AA Change: V40A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 2.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217350
Meta Mutation Damage Score 0.2865 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 94.9%
  • 20x: 87.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9230009I02Rik T C 11: 51,091,317 noncoding transcript Het
Adamts13 G A 2: 27,006,324 probably null Het
Chac1 C A 2: 119,353,469 A184E probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Csmd1 T A 8: 16,190,026 Y1124F probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Dyrk4 T C 6: 126,877,333 E499G possibly damaging Het
Fat1 T A 8: 45,018,037 I1603N probably damaging Het
Fbn1 A T 2: 125,342,891 C1660* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gm19684 A T 17: 36,121,900 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Map4 A G 9: 109,978,969 Y34C probably damaging Het
Mapk8 C T 14: 33,392,992 R189H probably damaging Het
Mgst1 C T 6: 138,147,751 T21M probably damaging Het
Msh2 A G 17: 87,680,052 T207A probably benign Het
Mthfd2 A G 6: 83,313,394 V85A probably damaging Het
Muc4 A G 16: 32,752,002 S627G probably benign Het
Nbeal2 G A 9: 110,628,195 T2266I probably damaging Het
Olfr623 T C 7: 103,660,528 T241A probably damaging Het
Olfr828 T C 9: 18,815,706 Y196C probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd6ip A T 9: 113,674,510 probably benign Het
Piwil2 T C 14: 70,395,374 D583G probably benign Het
Plin4 T A 17: 56,103,966 M1022L probably benign Het
Rbm48 A G 5: 3,590,438 S314P probably benign Het
Rbms3 A T 9: 117,629,792 probably benign Het
Snx14 A T 9: 88,383,996 S726T possibly damaging Het
Trim43c A T 9: 88,843,034 H202L probably benign Het
Trip12 A G 1: 84,744,009 F1334S probably damaging Het
Tyk2 T C 9: 21,116,167 H503R probably benign Het
Ubr2 G A 17: 46,967,083 Q745* probably null Het
Ush2a T A 1: 188,542,818 Y1829* probably null Het
Vmn2r65 T A 7: 84,943,645 E451D probably benign Het
Other mutations in Olfr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Olfr26 APN 9 38855799 missense probably benign 0.00
IGL01909:Olfr26 APN 9 38855717 nonsense probably null
IGL02146:Olfr26 APN 9 38855358 missense probably benign 0.01
IGL02229:Olfr26 APN 9 38855416 missense possibly damaging 0.62
IGL02382:Olfr26 APN 9 38855068 missense probably benign
IGL03007:Olfr26 APN 9 38855296 missense probably damaging 1.00
IGL03118:Olfr26 APN 9 38855230 missense probably damaging 1.00
PIT4403001:Olfr26 UTSW 9 38855380 missense probably benign 0.39
R0590:Olfr26 UTSW 9 38855470 missense probably damaging 0.99
R1779:Olfr26 UTSW 9 38855550 missense possibly damaging 0.55
R1796:Olfr26 UTSW 9 38855524 missense probably benign 0.01
R2083:Olfr26 UTSW 9 38855341 missense probably benign 0.10
R3420:Olfr26 UTSW 9 38855325 missense possibly damaging 0.92
R3421:Olfr26 UTSW 9 38855325 missense possibly damaging 0.92
R4328:Olfr26 UTSW 9 38855836 missense possibly damaging 0.62
R4470:Olfr26 UTSW 9 38855631 missense probably damaging 1.00
R4471:Olfr26 UTSW 9 38855631 missense probably damaging 1.00
R5047:Olfr26 UTSW 9 38855289 missense probably benign 0.36
R5267:Olfr26 UTSW 9 38855805 missense probably damaging 1.00
R5318:Olfr26 UTSW 9 38855448 missense probably damaging 1.00
R6502:Olfr26 UTSW 9 38855637 missense probably damaging 0.99
R7221:Olfr26 UTSW 9 38855242 missense probably damaging 1.00
R7297:Olfr26 UTSW 9 38855949 missense probably damaging 1.00
R7448:Olfr26 UTSW 9 38855116 missense probably damaging 1.00
R7525:Olfr26 UTSW 9 38855238 missense possibly damaging 0.89
R8040:Olfr26 UTSW 9 38855164 missense probably damaging 0.99
R8303:Olfr26 UTSW 9 38855541 missense probably damaging 1.00
Z1177:Olfr26 UTSW 9 38855235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAATTCACACCTAACTGGGAGACA -3'
(R):5'- TTTCTTCCCAAGAAAGTTCACCAGCA -3'

Sequencing Primer
(F):5'- ACAGGTATGCTCATATTGGTGAGAC -3'
(R):5'- CACCAGCATTTTGGGTGTAATGAC -3'
Posted On2013-11-08