Incidental Mutation 'R0862:Pdcd6ip'
ID82160
Institutional Source Beutler Lab
Gene Symbol Pdcd6ip
Ensembl Gene ENSMUSG00000032504
Gene Nameprogrammed cell death 6 interacting protein
SynonymsAlix, AIP1
MMRRC Submission 039036-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0862 (G1)
Quality Score198
Status Validated
Chromosome9
Chromosomal Location113651744-113708259 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 113674510 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035086] [ENSMUST00000111861]
Predicted Effect probably benign
Transcript: ENSMUST00000035086
SMART Domains Protein: ENSMUSP00000035086
Gene: ENSMUSG00000032504

DomainStartEndE-ValueType
BRO1 3 382 1.99e-160 SMART
Pfam:ALIX_LYPXL_bnd 408 702 3.6e-91 PFAM
low complexity region 731 812 N/A INTRINSIC
Blast:BRO1 813 839 2e-11 BLAST
low complexity region 840 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111861
SMART Domains Protein: ENSMUSP00000107492
Gene: ENSMUSG00000032504

DomainStartEndE-ValueType
BRO1 3 387 3.46e-160 SMART
Pfam:ALIX_LYPXL_bnd 417 706 8.8e-96 PFAM
low complexity region 736 817 N/A INTRINSIC
Blast:BRO1 818 844 2e-11 BLAST
low complexity region 845 874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135545
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 94.9%
  • 20x: 87.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased body and brain size and exhibit structural defects in the epithelium of the choroid plexus and in the brain ependyma that culminate in excessive cell extrusion, enlargement of the lateral ventricles, and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9230009I02Rik T C 11: 51,091,317 noncoding transcript Het
Adamts13 G A 2: 27,006,324 probably null Het
Chac1 C A 2: 119,353,469 A184E probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Csmd1 T A 8: 16,190,026 Y1124F probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Dyrk4 T C 6: 126,877,333 E499G possibly damaging Het
Fat1 T A 8: 45,018,037 I1603N probably damaging Het
Fbn1 A T 2: 125,342,891 C1660* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gm19684 A T 17: 36,121,900 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Map4 A G 9: 109,978,969 Y34C probably damaging Het
Mapk8 C T 14: 33,392,992 R189H probably damaging Het
Mgst1 C T 6: 138,147,751 T21M probably damaging Het
Msh2 A G 17: 87,680,052 T207A probably benign Het
Mthfd2 A G 6: 83,313,394 V85A probably damaging Het
Muc4 A G 16: 32,752,002 S627G probably benign Het
Nbeal2 G A 9: 110,628,195 T2266I probably damaging Het
Olfr26 T C 9: 38,855,182 V40A possibly damaging Het
Olfr623 T C 7: 103,660,528 T241A probably damaging Het
Olfr828 T C 9: 18,815,706 Y196C probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Piwil2 T C 14: 70,395,374 D583G probably benign Het
Plin4 T A 17: 56,103,966 M1022L probably benign Het
Rbm48 A G 5: 3,590,438 S314P probably benign Het
Rbms3 A T 9: 117,629,792 probably benign Het
Snx14 A T 9: 88,383,996 S726T possibly damaging Het
Trim43c A T 9: 88,843,034 H202L probably benign Het
Trip12 A G 1: 84,744,009 F1334S probably damaging Het
Tyk2 T C 9: 21,116,167 H503R probably benign Het
Ubr2 G A 17: 46,967,083 Q745* probably null Het
Ush2a T A 1: 188,542,818 Y1829* probably null Het
Vmn2r65 T A 7: 84,943,645 E451D probably benign Het
Other mutations in Pdcd6ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pdcd6ip APN 9 113697518 missense possibly damaging 0.89
IGL00814:Pdcd6ip APN 9 113687653 missense probably damaging 0.97
IGL01092:Pdcd6ip APN 9 113680181 splice site probably benign
IGL01621:Pdcd6ip APN 9 113685422 missense probably benign 0.03
IGL01781:Pdcd6ip APN 9 113691498 missense probably damaging 1.00
IGL02158:Pdcd6ip APN 9 113680053 nonsense probably null
IGL03136:Pdcd6ip APN 9 113691499 missense probably damaging 1.00
IGL03137:Pdcd6ip APN 9 113657145 missense possibly damaging 0.69
IGL03246:Pdcd6ip APN 9 113678417 missense possibly damaging 0.93
R0230:Pdcd6ip UTSW 9 113685293 splice site probably benign
R0284:Pdcd6ip UTSW 9 113662504 missense probably damaging 1.00
R0864:Pdcd6ip UTSW 9 113674510 splice site probably benign
R1025:Pdcd6ip UTSW 9 113662286 missense probably damaging 1.00
R1687:Pdcd6ip UTSW 9 113700019 missense probably damaging 1.00
R1699:Pdcd6ip UTSW 9 113678354 missense probably damaging 1.00
R1957:Pdcd6ip UTSW 9 113708022 missense probably damaging 1.00
R2317:Pdcd6ip UTSW 9 113672774 missense probably benign 0.03
R2698:Pdcd6ip UTSW 9 113674507 splice site probably null
R4182:Pdcd6ip UTSW 9 113700010 missense probably benign 0.00
R5154:Pdcd6ip UTSW 9 113691542 missense probably damaging 1.00
R5229:Pdcd6ip UTSW 9 113678333 missense probably damaging 0.99
R5391:Pdcd6ip UTSW 9 113691518 missense probably damaging 1.00
R5972:Pdcd6ip UTSW 9 113662298 missense probably benign 0.07
R6149:Pdcd6ip UTSW 9 113659871 missense probably benign 0.03
R6406:Pdcd6ip UTSW 9 113674344 missense possibly damaging 0.81
R6514:Pdcd6ip UTSW 9 113689694 missense probably benign 0.43
R6869:Pdcd6ip UTSW 9 113655106 missense unknown
R6888:Pdcd6ip UTSW 9 113671837 missense probably benign 0.04
R7078:Pdcd6ip UTSW 9 113659885 missense probably benign 0.01
R7683:Pdcd6ip UTSW 9 113687695 missense probably damaging 1.00
R8260:Pdcd6ip UTSW 9 113672797 missense probably benign 0.05
R8376:Pdcd6ip UTSW 9 113689616 missense probably damaging 1.00
Z1177:Pdcd6ip UTSW 9 113685369 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAGCAGCTCAGGTAGCTCTTTTATCA -3'
(R):5'- TTCTCCAGCTCCGACACCCA -3'

Sequencing Primer
(F):5'- AGGTACAGTGTCTCCAGACA -3'
(R):5'- gaaacaggatttctttgttttagctc -3'
Posted On2013-11-08