Incidental Mutation 'R0862:Rbms3'
ID82161
Institutional Source Beutler Lab
Gene Symbol Rbms3
Ensembl Gene ENSMUSG00000039607
Gene NameRNA binding motif, single stranded interacting protein
Synonyms
MMRRC Submission 039036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0862 (G1)
Quality Score178
Status Validated
Chromosome9
Chromosomal Location116572746-117629913 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 117629792 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164018]
Predicted Effect probably benign
Transcript: ENSMUST00000164018
SMART Domains Protein: ENSMUSP00000131371
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 76 98 N/A INTRINSIC
RRM 106 174 1.2e-17 SMART
RRM 185 257 1.49e-13 SMART
low complexity region 433 443 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 94.9%
  • 20x: 87.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9230009I02Rik T C 11: 51,091,317 noncoding transcript Het
Adamts13 G A 2: 27,006,324 probably null Het
Chac1 C A 2: 119,353,469 A184E probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Csmd1 T A 8: 16,190,026 Y1124F probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Dyrk4 T C 6: 126,877,333 E499G possibly damaging Het
Fat1 T A 8: 45,018,037 I1603N probably damaging Het
Fbn1 A T 2: 125,342,891 C1660* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gm19684 A T 17: 36,121,900 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Map4 A G 9: 109,978,969 Y34C probably damaging Het
Mapk8 C T 14: 33,392,992 R189H probably damaging Het
Mgst1 C T 6: 138,147,751 T21M probably damaging Het
Msh2 A G 17: 87,680,052 T207A probably benign Het
Mthfd2 A G 6: 83,313,394 V85A probably damaging Het
Muc4 A G 16: 32,752,002 S627G probably benign Het
Nbeal2 G A 9: 110,628,195 T2266I probably damaging Het
Olfr26 T C 9: 38,855,182 V40A possibly damaging Het
Olfr623 T C 7: 103,660,528 T241A probably damaging Het
Olfr828 T C 9: 18,815,706 Y196C probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd6ip A T 9: 113,674,510 probably benign Het
Piwil2 T C 14: 70,395,374 D583G probably benign Het
Plin4 T A 17: 56,103,966 M1022L probably benign Het
Rbm48 A G 5: 3,590,438 S314P probably benign Het
Snx14 A T 9: 88,383,996 S726T possibly damaging Het
Trim43c A T 9: 88,843,034 H202L probably benign Het
Trip12 A G 1: 84,744,009 F1334S probably damaging Het
Tyk2 T C 9: 21,116,167 H503R probably benign Het
Ubr2 G A 17: 46,967,083 Q745* probably null Het
Ush2a T A 1: 188,542,818 Y1829* probably null Het
Vmn2r65 T A 7: 84,943,645 E451D probably benign Het
Other mutations in Rbms3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Rbms3 APN 9 117110115 missense probably damaging 0.99
IGL01859:Rbms3 APN 9 116959538 missense probably damaging 1.00
IGL01962:Rbms3 APN 9 116695811 splice site probably benign
IGL03034:Rbms3 APN 9 117251811 utr 5 prime probably benign
PIT4810001:Rbms3 UTSW 9 117056793 missense probably damaging 0.98
R0864:Rbms3 UTSW 9 117629792 splice site probably benign
R0939:Rbms3 UTSW 9 117109960 critical splice donor site probably null
R1796:Rbms3 UTSW 9 116719333 missense probably damaging 1.00
R1808:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
R1826:Rbms3 UTSW 9 116822868 missense probably damaging 1.00
R2213:Rbms3 UTSW 9 116959466 critical splice donor site probably null
R3719:Rbms3 UTSW 9 116582862 missense probably benign 0.11
R3935:Rbms3 UTSW 9 116636391 missense probably damaging 1.00
R4270:Rbms3 UTSW 9 117056748 missense probably damaging 1.00
R4822:Rbms3 UTSW 9 116944373 intron probably benign
R4943:Rbms3 UTSW 9 116678505 intron probably benign
R5445:Rbms3 UTSW 9 117251785 missense possibly damaging 0.74
R5997:Rbms3 UTSW 9 116719389 missense probably damaging 1.00
R6848:Rbms3 UTSW 9 117251741 missense probably damaging 1.00
R6944:Rbms3 UTSW 9 117110105 missense probably damaging 0.99
R7205:Rbms3 UTSW 9 116586017 critical splice donor site probably null
R7419:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
R8267:Rbms3 UTSW 9 117056755 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCATCGGTCACACTGAGGCATAAAC -3'
(R):5'- CGTTGTTACTCTGTTGCAGGCAAG -3'

Sequencing Primer
(F):5'- TGGAATTTAAACTCTGACACGC -3'
(R):5'- TGTTGCAGGCAAGTAGCCC -3'
Posted On2013-11-08