Mutagenetix > Incidental Mutations

Incidental Mutation 'R0862:Msh2'

82171

Institutional Source

Beutler Lab

Gene Symbol

Msh2

Ensembl Gene

ENSMUSG00000024151

Gene Name

mutS homolog 2

Synonyms

MMRRC Submission

039036-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.843) question?

Stock #

R0862 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87672330-87723713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87680052 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 207 (T207A)

Ref Sequence

ENSEMBL: ENSMUSP00000024967 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024967]

Predicted Effect

probably benign
Transcript: ENSMUST00000024967
AA Change: T207A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024967
Gene: ENSMUSG00000024151
AA Change: T207A

Domain	Start	End	E-Value	Type
Pfam:MutS_I	17	132	4.6e-22	PFAM
Pfam:MutS_II	150	290	6.7e-23	PFAM
MUTSd	321	645	1e-105	SMART
MUTSac	662	849	3.54e-124	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172855

SMART Domains

Protein: ENSMUSP00000133650
Gene: ENSMUSG00000024151

Domain	Start	End	E-Value	Type
Pfam:MutS_I	13	129	3.8e-22	PFAM
Pfam:MutS_II	103	193	2.5e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174240

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 94.9%
20x: 87.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a number of different targeted mutations develop lymphomas. In addition, depending on the allele, mutants may show intestinal adenocarcinomas and reduced class switch recombination or adenocarcinomas and abnormal mismatch repair or squamous cell carcinomas and skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
9230009I02Rik	T	C	11: 51,091,317		noncoding transcript	Het
Adamts13	G	A	2: 27,006,324		probably null	Het
Chac1	C	A	2: 119,353,469	A184E	probably damaging	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Csmd1	T	A	8: 16,190,026	Y1124F	probably damaging	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Dyrk4	T	C	6: 126,877,333	E499G	possibly damaging	Het
Fat1	T	A	8: 45,018,037	I1603N	probably damaging	Het
Fbn1	A	T	2: 125,342,891	C1660*	probably null	Het
Gapt	G	C	13: 110,353,739	T130R	probably damaging	Het
Gm19684	A	T	17: 36,121,900		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Map4	A	G	9: 109,978,969	Y34C	probably damaging	Het
Mapk8	C	T	14: 33,392,992	R189H	probably damaging	Het
Mgst1	C	T	6: 138,147,751	T21M	probably damaging	Het
Mthfd2	A	G	6: 83,313,394	V85A	probably damaging	Het
Muc4	A	G	16: 32,752,002	S627G	probably benign	Het
Nbeal2	G	A	9: 110,628,195	T2266I	probably damaging	Het
Olfr26	T	C	9: 38,855,182	V40A	possibly damaging	Het
Olfr623	T	C	7: 103,660,528	T241A	probably damaging	Het
Olfr828	T	C	9: 18,815,706	Y196C	probably damaging	Het
Pcdhb2	G	A	18: 37,295,657	V228I	possibly damaging	Het
Pdcd6ip	A	T	9: 113,674,510		probably benign	Het
Piwil2	T	C	14: 70,395,374	D583G	probably benign	Het
Plin4	T	A	17: 56,103,966	M1022L	probably benign	Het
Rbm48	A	G	5: 3,590,438	S314P	probably benign	Het
Rbms3	A	T	9: 117,629,792		probably benign	Het
Snx14	A	T	9: 88,383,996	S726T	possibly damaging	Het
Trim43c	A	T	9: 88,843,034	H202L	probably benign	Het
Trip12	A	G	1: 84,744,009	F1334S	probably damaging	Het
Tyk2	T	C	9: 21,116,167	H503R	probably benign	Het
Ubr2	G	A	17: 46,967,083	Q745*	probably null	Het
Ush2a	T	A	1: 188,542,818	Y1829*	probably null	Het
Vmn2r65	T	A	7: 84,943,645	E451D	probably benign	Het

Other mutations in Msh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01405:Msh2	APN	17	87678235	missense	probably damaging	1.00
IGL01602:Msh2	APN	17	87696489	unclassified	probably benign
IGL01605:Msh2	APN	17	87696489	unclassified	probably benign
IGL01775:Msh2	APN	17	87682646	missense	possibly damaging	0.94
IGL02243:Msh2	APN	17	87678368	splice site	probably benign
IGL02524:Msh2	APN	17	87678357	missense	probably benign	0.01
IGL02730:Msh2	APN	17	87707215	missense	probably damaging	1.00
IGL02743:Msh2	APN	17	87707215	missense	probably damaging	1.00
IGL03049:Msh2	APN	17	87708509	missense	probably damaging	1.00
IGL03282:Msh2	APN	17	87689002	missense	probably benign	0.00
IGL03286:Msh2	APN	17	87682667	missense	possibly damaging	0.92
R0011:Msh2	UTSW	17	87680093	intron	probably benign
R0363:Msh2	UTSW	17	87717476	missense	probably benign	0.30
R0520:Msh2	UTSW	17	87717544	missense	possibly damaging	0.77
R0633:Msh2	UTSW	17	87672810	splice site	probably null
R0864:Msh2	UTSW	17	87680052	missense	probably benign
R1146:Msh2	UTSW	17	87680060	missense	probably benign	0.00
R1146:Msh2	UTSW	17	87680060	missense	probably benign	0.00
R1264:Msh2	UTSW	17	87707179	splice site	probably null
R1459:Msh2	UTSW	17	87678343	missense	probably benign	0.01
R1572:Msh2	UTSW	17	87718652	missense	possibly damaging	0.89
R1592:Msh2	UTSW	17	87680013	splice site	probably null
R1647:Msh2	UTSW	17	87672636	missense	probably benign
R1984:Msh2	UTSW	17	87719296	missense	probably damaging	1.00
R2298:Msh2	UTSW	17	87708502	missense	probably damaging	0.99
R2871:Msh2	UTSW	17	87685584	missense	possibly damaging	0.61
R2871:Msh2	UTSW	17	87685584	missense	possibly damaging	0.61
R4383:Msh2	UTSW	17	87689138	missense	probably benign	0.00
R4411:Msh2	UTSW	17	87717604	missense	probably damaging	0.97
R4589:Msh2	UTSW	17	87680032	missense	possibly damaging	0.67
R4598:Msh2	UTSW	17	87708578	missense	probably damaging	1.00
R4599:Msh2	UTSW	17	87708578	missense	probably damaging	1.00
R4712:Msh2	UTSW	17	87678385	intron	probably benign
R4714:Msh2	UTSW	17	87718789	missense	probably damaging	1.00
R4834:Msh2	UTSW	17	87723413	missense	probably benign
R4842:Msh2	UTSW	17	87723413	missense	probably benign
R4859:Msh2	UTSW	17	87718759	missense	possibly damaging	0.94
R5007:Msh2	UTSW	17	87723413	missense	probably benign
R5008:Msh2	UTSW	17	87723413	missense	probably benign
R5010:Msh2	UTSW	17	87723413	missense	probably benign
R5014:Msh2	UTSW	17	87717576	missense	possibly damaging	0.83
R5048:Msh2	UTSW	17	87672768	missense	probably damaging	1.00
R5133:Msh2	UTSW	17	87723413	missense	probably benign
R5162:Msh2	UTSW	17	87723413	missense	probably benign
R5163:Msh2	UTSW	17	87723413	missense	probably benign
R5183:Msh2	UTSW	17	87723413	missense	probably benign
R5184:Msh2	UTSW	17	87723413	missense	probably benign
R5597:Msh2	UTSW	17	87723361	missense	probably benign	0.04
R5655:Msh2	UTSW	17	87719443	missense	possibly damaging	0.82
R5973:Msh2	UTSW	17	87708583	missense	probably damaging	1.00
R6191:Msh2	UTSW	17	87723472	missense	probably benign	0.03
R6632:Msh2	UTSW	17	87712666	missense	possibly damaging	0.49
R7260:Msh2	UTSW	17	87717619	missense	probably damaging	0.97
R7358:Msh2	UTSW	17	87717529	missense	possibly damaging	0.89
X0058:Msh2	UTSW	17	87679934	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCGGCAATCTTTCTCAGTTTGAAG -3'
(R):5'- TGGAACCACAGCTCAGTGCTAGAG -3'

Sequencing Primer
(F):5'- GACATCCTGTTTGGTAACAATGAC -3'
(R):5'- tcaggggtagagcaccag -3'

Posted On

2013-11-08