Incidental Mutation 'R0863:Pask'
ID 82174
Institutional Source Beutler Lab
Gene Symbol Pask
Ensembl Gene ENSMUSG00000026274
Gene Name PAS domain containing serine/threonine kinase
Synonyms Paskin
MMRRC Submission 039037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R0863 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 93308770-93343482 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93314339 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1219 (F1219I)
Ref Sequence ENSEMBL: ENSMUSP00000027493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027493]
AlphaFold Q8CEE6
Predicted Effect probably damaging
Transcript: ENSMUST00000027493
AA Change: F1219I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: F1219I

DomainStartEndE-ValueType
PAS 119 186 3.87e-8 SMART
PAS 333 400 3.08e-2 SMART
low complexity region 907 918 N/A INTRINSIC
low complexity region 1043 1054 N/A INTRINSIC
S_TKc 1059 1311 8.16e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188069
Meta Mutation Damage Score 0.6979 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
2310016G11Rik A G 7: 44,677,808 noncoding transcript Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca14 A T 7: 120,216,230 T234S probably benign Het
Acap1 C A 11: 69,887,056 V119L probably damaging Het
Actr2 C T 11: 20,080,760 V163I probably benign Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Arnt2 T A 7: 84,265,584 K524M probably damaging Het
Brca1 T C 11: 101,524,770 Y846C probably benign Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Cep350 T A 1: 155,862,235 I2621L probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fank1 A G 7: 133,880,623 R73G possibly damaging Het
Fes A T 7: 80,380,886 W552R probably damaging Het
Fsd2 A G 7: 81,542,165 V488A possibly damaging Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gm9493 A T 19: 23,619,809 Q23L probably benign Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lonp1 T C 17: 56,618,331 K487R probably damaging Het
Ltbp1 A G 17: 75,252,386 Y290C probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Ms4a10 C T 19: 10,968,593 G58D probably damaging Het
Muc5b A G 7: 141,867,717 S4315G probably benign Het
Nlrp1b T A 11: 71,181,347 T557S probably benign Het
Nlrp3 A G 11: 59,565,850 D946G probably benign Het
Obscn T C 11: 58,995,415 probably benign Het
Olfr469 T C 7: 107,823,374 S32G probably benign Het
Olfr509 A G 7: 108,645,658 I306T probably benign Het
Olfr866 A T 9: 20,027,213 S242T probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Plec G A 15: 76,174,080 Q3751* probably null Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sema4a C T 3: 88,448,149 probably benign Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Spag1 G T 15: 36,192,047 K217N probably damaging Het
Ssh1 C T 5: 113,966,731 R9H probably damaging Het
St3gal4 C A 9: 35,053,448 V155F probably damaging Het
Stxbp5 C T 10: 9,809,040 E539K possibly damaging Het
Tbc1d7 G T 13: 43,154,685 probably benign Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Ttc21b T C 2: 66,242,773 I190V probably benign Het
Ttn T C 2: 76,707,047 T34846A probably benign Het
Ube4a A G 9: 44,949,816 V232A possibly damaging Het
Uri1 A T 7: 37,969,675 D122E probably damaging Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zan T A 5: 137,458,639 E1278D unknown Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Pask
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Pask APN 1 93310852 missense probably benign 0.02
IGL01620:Pask APN 1 93310122 missense possibly damaging 0.87
IGL01959:Pask APN 1 93334607 missense probably benign 0.03
IGL02170:Pask APN 1 93310884 missense possibly damaging 0.69
IGL02499:Pask APN 1 93321095 nonsense probably null
IGL02670:Pask APN 1 93310818 missense probably damaging 1.00
IGL03066:Pask APN 1 93330866 missense probably benign 0.02
IGL03210:Pask APN 1 93319992 missense possibly damaging 0.92
R0472:Pask UTSW 1 93320917 missense probably benign 0.00
R0524:Pask UTSW 1 93310834 missense probably damaging 1.00
R0854:Pask UTSW 1 93327400 missense probably damaging 0.99
R0854:Pask UTSW 1 93327412 missense probably damaging 1.00
R0854:Pask UTSW 1 93327434 missense possibly damaging 0.79
R1052:Pask UTSW 1 93330827 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1831:Pask UTSW 1 93320769 splice site probably null
R1958:Pask UTSW 1 93321458 missense probably benign 0.00
R2143:Pask UTSW 1 93321297 missense probably benign 0.00
R2144:Pask UTSW 1 93321297 missense probably benign 0.00
R2145:Pask UTSW 1 93321297 missense probably benign 0.00
R2509:Pask UTSW 1 93330763 missense possibly damaging 0.62
R2858:Pask UTSW 1 93321651 missense probably benign 0.00
R2899:Pask UTSW 1 93334547 missense probably damaging 1.00
R3545:Pask UTSW 1 93317115 missense probably damaging 1.00
R3778:Pask UTSW 1 93327467 missense probably damaging 1.00
R4111:Pask UTSW 1 93310818 missense probably damaging 1.00
R4514:Pask UTSW 1 93322133 missense probably benign 0.03
R4527:Pask UTSW 1 93320502 missense probably benign
R4580:Pask UTSW 1 93322108 missense probably benign 0.36
R4718:Pask UTSW 1 93322196 missense possibly damaging 0.67
R4775:Pask UTSW 1 93337524 missense probably damaging 0.97
R5036:Pask UTSW 1 93322079 nonsense probably null
R5070:Pask UTSW 1 93330874 missense probably damaging 1.00
R5084:Pask UTSW 1 93322097 missense probably benign
R5151:Pask UTSW 1 93334628 missense probably damaging 1.00
R5196:Pask UTSW 1 93310083 unclassified probably benign
R5643:Pask UTSW 1 93337343 critical splice donor site probably null
R5739:Pask UTSW 1 93322056 missense probably benign
R6126:Pask UTSW 1 93314359 missense probably damaging 1.00
R7161:Pask UTSW 1 93310905 missense probably benign
R7284:Pask UTSW 1 93320669 missense probably benign 0.01
R7289:Pask UTSW 1 93331587 missense probably damaging 1.00
R8277:Pask UTSW 1 93325363 critical splice donor site probably null
R8303:Pask UTSW 1 93320564 missense probably benign 0.10
R8309:Pask UTSW 1 93312851 nonsense probably null
R8321:Pask UTSW 1 93320655 missense possibly damaging 0.85
R8476:Pask UTSW 1 93321639 missense probably benign 0.00
R8814:Pask UTSW 1 93320585 missense probably benign 0.00
R9061:Pask UTSW 1 93325469 nonsense probably null
R9198:Pask UTSW 1 93337483 missense possibly damaging 0.72
R9406:Pask UTSW 1 93324265 missense probably benign 0.02
R9578:Pask UTSW 1 93335668 missense probably benign 0.00
Z1088:Pask UTSW 1 93316801 missense probably damaging 1.00
Z1177:Pask UTSW 1 93335732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATGTCTAGCTACCTGCACAC -3'
(R):5'- TCCTGCTTCAACCTCGAACTGAAC -3'

Sequencing Primer
(F):5'- TGCAGAACATTTTCCTCATCAC -3'
(R):5'- CAAACTCTGCTGTGTGAGGC -3'
Posted On 2013-11-08