Incidental Mutation 'R0863:Arnt2'
ID82193
Institutional Source Beutler Lab
Gene Symbol Arnt2
Ensembl Gene ENSMUSG00000015709
Gene Namearyl hydrocarbon receptor nuclear translocator 2
SynonymsbHLHe1
MMRRC Submission 039037-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0863 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location84246278-84410176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84265584 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 524 (K524M)
Ref Sequence ENSEMBL: ENSMUSP00000147129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000208232] [ENSMUST00000209133]
Predicted Effect probably damaging
Transcript: ENSMUST00000085077
AA Change: K535M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: K535M

DomainStartEndE-ValueType
HLH 69 122 1.42e-14 SMART
PAS 137 204 1.28e-8 SMART
low complexity region 225 236 N/A INTRINSIC
PAS 325 391 4.15e-8 SMART
PAC 398 441 7.93e-5 SMART
low complexity region 502 526 N/A INTRINSIC
low complexity region 597 626 N/A INTRINSIC
low complexity region 653 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207459
Predicted Effect probably benign
Transcript: ENSMUST00000208129
Predicted Effect probably damaging
Transcript: ENSMUST00000208232
AA Change: K524M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000208564
Predicted Effect probably damaging
Transcript: ENSMUST00000209133
AA Change: K524M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0825 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
2310016G11Rik A G 7: 44,677,808 noncoding transcript Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca14 A T 7: 120,216,230 T234S probably benign Het
Acap1 C A 11: 69,887,056 V119L probably damaging Het
Actr2 C T 11: 20,080,760 V163I probably benign Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Brca1 T C 11: 101,524,770 Y846C probably benign Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Cep350 T A 1: 155,862,235 I2621L probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fank1 A G 7: 133,880,623 R73G possibly damaging Het
Fes A T 7: 80,380,886 W552R probably damaging Het
Fsd2 A G 7: 81,542,165 V488A possibly damaging Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gm9493 A T 19: 23,619,809 Q23L probably benign Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lonp1 T C 17: 56,618,331 K487R probably damaging Het
Ltbp1 A G 17: 75,252,386 Y290C probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Ms4a10 C T 19: 10,968,593 G58D probably damaging Het
Muc5b A G 7: 141,867,717 S4315G probably benign Het
Nlrp1b T A 11: 71,181,347 T557S probably benign Het
Nlrp3 A G 11: 59,565,850 D946G probably benign Het
Obscn T C 11: 58,995,415 probably benign Het
Olfr469 T C 7: 107,823,374 S32G probably benign Het
Olfr509 A G 7: 108,645,658 I306T probably benign Het
Olfr866 A T 9: 20,027,213 S242T probably damaging Het
Pask A T 1: 93,314,339 F1219I probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Plec G A 15: 76,174,080 Q3751* probably null Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sema4a C T 3: 88,448,149 probably benign Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Spag1 G T 15: 36,192,047 K217N probably damaging Het
Ssh1 C T 5: 113,966,731 R9H probably damaging Het
St3gal4 C A 9: 35,053,448 V155F probably damaging Het
Stxbp5 C T 10: 9,809,040 E539K possibly damaging Het
Tbc1d7 G T 13: 43,154,685 probably benign Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Ttc21b T C 2: 66,242,773 I190V probably benign Het
Ttn T C 2: 76,707,047 T34846A probably benign Het
Ube4a A G 9: 44,949,816 V232A possibly damaging Het
Uri1 A T 7: 37,969,675 D122E probably damaging Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zan T A 5: 137,458,639 E1278D unknown Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Arnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Arnt2 APN 7 84285829 missense probably benign 0.01
IGL01525:Arnt2 APN 7 84275408 missense possibly damaging 0.70
IGL02331:Arnt2 APN 7 84265624 missense probably damaging 1.00
IGL02483:Arnt2 APN 7 84251397 missense probably damaging 1.00
IGL02863:Arnt2 APN 7 84267937 missense probably damaging 1.00
IGL03207:Arnt2 APN 7 84343834 missense possibly damaging 0.93
Arnold2 UTSW 7 84347530 missense probably damaging 1.00
porker UTSW 7 84343942 missense probably damaging 1.00
R0024:Arnt2 UTSW 7 84284126 missense probably benign 0.03
R0058:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0058:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0060:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0113:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0114:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0201:Arnt2 UTSW 7 84361659 nonsense probably null
R0514:Arnt2 UTSW 7 84304859 missense probably benign 0.00
R1800:Arnt2 UTSW 7 84275375 missense probably damaging 1.00
R1944:Arnt2 UTSW 7 84343751 missense probably benign 0.01
R1964:Arnt2 UTSW 7 84343789 missense possibly damaging 0.55
R2061:Arnt2 UTSW 7 84343870 missense probably damaging 1.00
R2216:Arnt2 UTSW 7 84275351 missense probably damaging 0.99
R3107:Arnt2 UTSW 7 84262444 missense possibly damaging 0.95
R3410:Arnt2 UTSW 7 84275447 missense probably damaging 1.00
R3739:Arnt2 UTSW 7 84343801 missense probably null 1.00
R4258:Arnt2 UTSW 7 84310955 missense probably damaging 0.98
R4486:Arnt2 UTSW 7 84275345 missense probably benign 0.03
R4489:Arnt2 UTSW 7 84275345 missense probably benign 0.03
R4668:Arnt2 UTSW 7 84275386 missense probably damaging 1.00
R5685:Arnt2 UTSW 7 84263265 missense probably benign 0.00
R5876:Arnt2 UTSW 7 84347512 missense probably damaging 1.00
R5923:Arnt2 UTSW 7 84262533 missense probably benign 0.32
R5926:Arnt2 UTSW 7 84343946 missense probably damaging 0.99
R6122:Arnt2 UTSW 7 84361565 missense probably damaging 1.00
R7021:Arnt2 UTSW 7 84343942 missense probably damaging 1.00
R7895:Arnt2 UTSW 7 84305198 missense probably benign
R7898:Arnt2 UTSW 7 84268947 splice site probably null
R8386:Arnt2 UTSW 7 84347539 missense probably damaging 1.00
X0066:Arnt2 UTSW 7 84285784 missense possibly damaging 0.93
Z1176:Arnt2 UTSW 7 84263196 missense probably benign 0.41
Z1177:Arnt2 UTSW 7 84263207 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCCCTCAGTGGTAATGTCAAGCTTC -3'
(R):5'- ATGCACTGTTCCAGGGTGTTCC -3'

Sequencing Primer
(F):5'- TGATGCTTTATAGCCAGGCAC -3'
(R):5'- TGTTCCCTGGTGGCCTG -3'
Posted On2013-11-08