Incidental Mutation 'R0863:Ube4a'
ID 82202
Institutional Source Beutler Lab
Gene Symbol Ube4a
Ensembl Gene ENSMUSG00000059890
Gene Name ubiquitination factor E4A
Synonyms 9930123J21Rik, UFD2b, 4732444G18Rik
MMRRC Submission 039037-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0863 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44923127-44965600 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44949816 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 232 (V232A)
Ref Sequence ENSEMBL: ENSMUSP00000149791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117506] [ENSMUST00000117549] [ENSMUST00000125642] [ENSMUST00000138559] [ENSMUST00000145657] [ENSMUST00000154287] [ENSMUST00000213193] [ENSMUST00000213666] [ENSMUST00000213890] [ENSMUST00000214761]
AlphaFold E9Q735
Predicted Effect probably benign
Transcript: ENSMUST00000117506
AA Change: V213A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113346
Gene: ENSMUSG00000059890
AA Change: V213A

DomainStartEndE-ValueType
low complexity region 288 299 N/A INTRINSIC
Pfam:Ufd2P_core 330 766 2.6e-101 PFAM
Pfam:Ufd2P_core 762 935 7.4e-61 PFAM
Ubox 953 1016 1.9e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117549
AA Change: V232A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112632
Gene: ENSMUSG00000059890
AA Change: V232A

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 991 3.4e-155 PFAM
Ubox 1010 1073 1.9e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125642
Predicted Effect possibly damaging
Transcript: ENSMUST00000138559
AA Change: V232A

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000145657
Predicted Effect probably benign
Transcript: ENSMUST00000154287
AA Change: V232A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123668
Gene: ENSMUSG00000059890
AA Change: V232A

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 547 4.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213193
Predicted Effect probably benign
Transcript: ENSMUST00000213666
Predicted Effect probably benign
Transcript: ENSMUST00000213890
Predicted Effect probably benign
Transcript: ENSMUST00000214761
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
2310016G11Rik A G 7: 44,677,808 noncoding transcript Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca14 A T 7: 120,216,230 T234S probably benign Het
Acap1 C A 11: 69,887,056 V119L probably damaging Het
Actr2 C T 11: 20,080,760 V163I probably benign Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Arnt2 T A 7: 84,265,584 K524M probably damaging Het
Brca1 T C 11: 101,524,770 Y846C probably benign Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Cep350 T A 1: 155,862,235 I2621L probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fank1 A G 7: 133,880,623 R73G possibly damaging Het
Fes A T 7: 80,380,886 W552R probably damaging Het
Fsd2 A G 7: 81,542,165 V488A possibly damaging Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gm9493 A T 19: 23,619,809 Q23L probably benign Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lonp1 T C 17: 56,618,331 K487R probably damaging Het
Ltbp1 A G 17: 75,252,386 Y290C probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Ms4a10 C T 19: 10,968,593 G58D probably damaging Het
Muc5b A G 7: 141,867,717 S4315G probably benign Het
Nlrp1b T A 11: 71,181,347 T557S probably benign Het
Nlrp3 A G 11: 59,565,850 D946G probably benign Het
Obscn T C 11: 58,995,415 probably benign Het
Olfr469 T C 7: 107,823,374 S32G probably benign Het
Olfr509 A G 7: 108,645,658 I306T probably benign Het
Olfr866 A T 9: 20,027,213 S242T probably damaging Het
Pask A T 1: 93,314,339 F1219I probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Plec G A 15: 76,174,080 Q3751* probably null Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sema4a C T 3: 88,448,149 probably benign Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Spag1 G T 15: 36,192,047 K217N probably damaging Het
Ssh1 C T 5: 113,966,731 R9H probably damaging Het
St3gal4 C A 9: 35,053,448 V155F probably damaging Het
Stxbp5 C T 10: 9,809,040 E539K possibly damaging Het
Tbc1d7 G T 13: 43,154,685 probably benign Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Ttc21b T C 2: 66,242,773 I190V probably benign Het
Ttn T C 2: 76,707,047 T34846A probably benign Het
Uri1 A T 7: 37,969,675 D122E probably damaging Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zan T A 5: 137,458,639 E1278D unknown Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Ube4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ube4a APN 9 44948141 missense probably damaging 1.00
IGL00857:Ube4a APN 9 44932386 missense probably damaging 1.00
IGL01067:Ube4a APN 9 44944865 missense probably damaging 0.96
White_way UTSW 9 44949753 nonsense probably null
R0243:Ube4a UTSW 9 44946178 unclassified probably benign
R0355:Ube4a UTSW 9 44944801 splice site probably benign
R0680:Ube4a UTSW 9 44948060 missense probably damaging 1.00
R0909:Ube4a UTSW 9 44939973 missense probably damaging 0.97
R1597:Ube4a UTSW 9 44929766 missense possibly damaging 0.93
R1611:Ube4a UTSW 9 44956737 intron probably benign
R1871:Ube4a UTSW 9 44944937 splice site probably null
R2069:Ube4a UTSW 9 44948099 missense probably damaging 0.96
R2518:Ube4a UTSW 9 44948137 missense probably benign 0.29
R3079:Ube4a UTSW 9 44960073 missense probably damaging 1.00
R3404:Ube4a UTSW 9 44929687 missense probably damaging 1.00
R3726:Ube4a UTSW 9 44933323 missense probably damaging 0.97
R3758:Ube4a UTSW 9 44949900 unclassified probably benign
R4027:Ube4a UTSW 9 44949900 unclassified probably benign
R4029:Ube4a UTSW 9 44949900 unclassified probably benign
R4111:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4113:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4238:Ube4a UTSW 9 44939999 missense probably damaging 1.00
R4365:Ube4a UTSW 9 44960081 missense probably damaging 1.00
R4471:Ube4a UTSW 9 44946532 unclassified probably benign
R4793:Ube4a UTSW 9 44948822 missense probably damaging 1.00
R5069:Ube4a UTSW 9 44940089 missense probably damaging 1.00
R5214:Ube4a UTSW 9 44948868 missense probably benign 0.22
R5225:Ube4a UTSW 9 44939960 critical splice donor site probably null
R5416:Ube4a UTSW 9 44941178 missense probably damaging 0.99
R5641:Ube4a UTSW 9 44950881 missense probably damaging 0.99
R5729:Ube4a UTSW 9 44933329 missense probably damaging 1.00
R5774:Ube4a UTSW 9 44953097 missense probably damaging 0.99
R5908:Ube4a UTSW 9 44948024 critical splice donor site probably null
R6191:Ube4a UTSW 9 44949753 nonsense probably null
R6752:Ube4a UTSW 9 44925948 missense probably damaging 1.00
R6886:Ube4a UTSW 9 44948843 missense probably damaging 0.96
R6911:Ube4a UTSW 9 44942758 missense probably damaging 1.00
R7417:Ube4a UTSW 9 44956713 missense probably benign 0.08
R7650:Ube4a UTSW 9 44933436 missense probably damaging 0.99
R7747:Ube4a UTSW 9 44925973 missense probably damaging 1.00
R7798:Ube4a UTSW 9 44933331 missense probably damaging 1.00
R7842:Ube4a UTSW 9 44949727 splice site probably null
R7853:Ube4a UTSW 9 44953010 missense probably benign 0.43
R8109:Ube4a UTSW 9 44935483 missense probably benign 0.00
R8223:Ube4a UTSW 9 44960035 missense possibly damaging 0.94
R8401:Ube4a UTSW 9 44941229 missense possibly damaging 0.84
R8523:Ube4a UTSW 9 44949832 missense probably damaging 1.00
R8838:Ube4a UTSW 9 44925963 missense probably damaging 1.00
R9093:Ube4a UTSW 9 44953164 missense possibly damaging 0.66
R9314:Ube4a UTSW 9 44942725 missense probably benign 0.00
R9365:Ube4a UTSW 9 44950893 missense probably benign 0.09
R9545:Ube4a UTSW 9 44932340 critical splice donor site probably null
X0025:Ube4a UTSW 9 44942818 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGTGACTCTGAGACCCTCTAACGC -3'
(R):5'- AGTTTAGCATGTGAGCCTGAAAGCC -3'

Sequencing Primer
(F):5'- CCCGCCATTAGAGGAGTTTTAAATTG -3'
(R):5'- ggcacacacattttatcccag -3'
Posted On 2013-11-08