Mutagenetix > Incidental Mutations

Incidental Mutation 'R0863:Actr2'

82206

Institutional Source

Beutler Lab

Gene Symbol

Actr2

Ensembl Gene

ENSMUSG00000020152

Gene Name

ARP2 actin-related protein 2

Synonyms

4921510D23Rik, D6Ertd746e, Arp2

MMRRC Submission

039037-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R0863 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20062304-20112913 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20080760 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 163 (V163I)

Ref Sequence

ENSEMBL: ENSMUSP00000000137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000137]

Predicted Effect

probably benign
Transcript: ENSMUST00000000137
AA Change: V163I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000000137
Gene: ENSMUSG00000020152
AA Change: V163I

Domain	Start	End	E-Value	Type
ACTIN	6	390	2.78e-208	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132022

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.4%
20x: 94.8%

Validation Efficiency

94% (59/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for this mutation exhibit modifies lethality associated with F5 null Tfpi heterozygous mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	A	T	9: 92,351,087	I88L	possibly damaging	Het
2310016G11Rik	A	G	7: 44,677,808		noncoding transcript	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abca14	A	T	7: 120,216,230	T234S	probably benign	Het
Acap1	C	A	11: 69,887,056	V119L	probably damaging	Het
Adcy4	T	C	14: 55,783,599	Y27C	probably damaging	Het
Arnt2	T	A	7: 84,265,584	K524M	probably damaging	Het
Brca1	T	C	11: 101,524,770	Y846C	probably benign	Het
Capn7	T	A	14: 31,369,757	C704S	possibly damaging	Het
Cep350	T	A	1: 155,862,235	I2621L	probably benign	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Cul9	T	C	17: 46,537,822		probably null	Het
Erc2	A	C	14: 28,025,148	N345T	probably benign	Het
Fank1	A	G	7: 133,880,623	R73G	possibly damaging	Het
Fes	A	T	7: 80,380,886	W552R	probably damaging	Het
Fsd2	A	G	7: 81,542,165	V488A	possibly damaging	Het
Gfm1	T	C	3: 67,474,595	S705P	probably damaging	Het
Gm9493	A	T	19: 23,619,809	Q23L	probably benign	Het
Gucy1b2	T	C	14: 62,419,062	D282G	probably benign	Het
H2-Ab1	T	C	17: 34,267,354	I129T	probably damaging	Het
H2-M10.3	T	A	17: 36,366,690	Y232F	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Lonp1	T	C	17: 56,618,331	K487R	probably damaging	Het
Ltbp1	A	G	17: 75,252,386	Y290C	probably damaging	Het
Mgea5	C	T	19: 45,782,986	A49T	probably benign	Het
Ms4a10	C	T	19: 10,968,593	G58D	probably damaging	Het
Muc5b	A	G	7: 141,867,717	S4315G	probably benign	Het
Nlrp1b	T	A	11: 71,181,347	T557S	probably benign	Het
Nlrp3	A	G	11: 59,565,850	D946G	probably benign	Het
Obscn	T	C	11: 58,995,415		probably benign	Het
Olfr469	T	C	7: 107,823,374	S32G	probably benign	Het
Olfr509	A	G	7: 108,645,658	I306T	probably benign	Het
Olfr866	A	T	9: 20,027,213	S242T	probably damaging	Het
Pask	A	T	1: 93,314,339	F1219I	probably damaging	Het
Pcdhb2	G	A	18: 37,295,657	V228I	possibly damaging	Het
Phf1	T	C	17: 26,937,140		probably benign	Het
Plec	G	A	15: 76,174,080	Q3751*	probably null	Het
Ppp1r12c	G	T	7: 4,486,366	Q240K	probably damaging	Het
Ralgapa1	A	T	12: 55,762,681	Y436*	probably null	Het
Ralgapa1	C	A	12: 55,782,777		probably benign	Het
Scel	T	A	14: 103,586,480	S381R	possibly damaging	Het
Sema4a	C	T	3: 88,448,149		probably benign	Het
Sltm	A	G	9: 70,561,908	T150A	probably benign	Het
Spag1	G	T	15: 36,192,047	K217N	probably damaging	Het
Ssh1	C	T	5: 113,966,731	R9H	probably damaging	Het
St3gal4	C	A	9: 35,053,448	V155F	probably damaging	Het
Stxbp5	C	T	10: 9,809,040	E539K	possibly damaging	Het
Tbc1d7	G	T	13: 43,154,685		probably benign	Het
Thnsl2	A	T	6: 71,134,224	L220*	probably null	Het
Tinf2	G	A	14: 55,680,109	P308S	probably benign	Het
Tnf	T	C	17: 35,201,144		probably benign	Het
Ttc21b	T	C	2: 66,242,773	I190V	probably benign	Het
Ttn	T	C	2: 76,707,047	T34846A	probably benign	Het
Ube4a	A	G	9: 44,949,816	V232A	possibly damaging	Het
Uri1	A	T	7: 37,969,675	D122E	probably damaging	Het
Vmn2r94	T	G	17: 18,257,711	Q146P	probably damaging	Het
Zan	T	A	5: 137,458,639	E1278D	unknown	Het
Zfhx4	T	A	3: 5,245,315	S919R	possibly damaging	Het

Other mutations in Actr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Actr2	APN	11	20094370	missense	probably benign	0.03
IGL00164:Actr2	APN	11	20080015	splice site	probably benign
IGL00566:Actr2	APN	11	20072487	missense	possibly damaging	0.92
IGL00822:Actr2	APN	11	20094367	missense	probably damaging	1.00
IGL02993:Actr2	APN	11	20072514	missense	probably damaging	1.00
IGL03330:Actr2	APN	11	20091330	missense	probably benign	0.01
R0092:Actr2	UTSW	11	20094308	missense	probably benign	0.00
R0129:Actr2	UTSW	11	20100939	splice site	probably benign
R0513:Actr2	UTSW	11	20080124	missense	probably damaging	1.00
R0848:Actr2	UTSW	11	20072584	missense	probably benign	0.02
R5175:Actr2	UTSW	11	20080114	missense	probably benign	0.25
R5364:Actr2	UTSW	11	20100797	intron	probably benign
R6544:Actr2	UTSW	11	20100933	missense	probably damaging	1.00
R7330:Actr2	UTSW	11	20072544	missense	probably damaging	1.00
X0021:Actr2	UTSW	11	20080702	missense	probably damaging	0.99
X0066:Actr2	UTSW	11	20080065	missense	probably benign	0.00
X0066:Actr2	UTSW	11	20080066	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TTGCTGTCTATGCCCGACAACC -3'
(R):5'- GGAAATGCTGGCTCTAAGCCTCAC -3'

Sequencing Primer
(F):5'- tctatgcccgacaacctaaac -3'
(R):5'- ACTAGCCACCTTTTTGTGGG -3'

Posted On

2013-11-08