Incidental Mutation 'R0863:Actr2'
ID82206
Institutional Source Beutler Lab
Gene Symbol Actr2
Ensembl Gene ENSMUSG00000020152
Gene NameARP2 actin-related protein 2
Synonyms4921510D23Rik, D6Ertd746e, Arp2
MMRRC Submission 039037-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R0863 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location20062304-20112913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20080760 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 163 (V163I)
Ref Sequence ENSEMBL: ENSMUSP00000000137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000137]
Predicted Effect probably benign
Transcript: ENSMUST00000000137
AA Change: V163I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000137
Gene: ENSMUSG00000020152
AA Change: V163I

DomainStartEndE-ValueType
ACTIN 6 390 2.78e-208 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132022
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for this mutation exhibit modifies lethality associated with F5 null Tfpi heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
2310016G11Rik A G 7: 44,677,808 noncoding transcript Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca14 A T 7: 120,216,230 T234S probably benign Het
Acap1 C A 11: 69,887,056 V119L probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Arnt2 T A 7: 84,265,584 K524M probably damaging Het
Brca1 T C 11: 101,524,770 Y846C probably benign Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Cep350 T A 1: 155,862,235 I2621L probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fank1 A G 7: 133,880,623 R73G possibly damaging Het
Fes A T 7: 80,380,886 W552R probably damaging Het
Fsd2 A G 7: 81,542,165 V488A possibly damaging Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gm9493 A T 19: 23,619,809 Q23L probably benign Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lonp1 T C 17: 56,618,331 K487R probably damaging Het
Ltbp1 A G 17: 75,252,386 Y290C probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Ms4a10 C T 19: 10,968,593 G58D probably damaging Het
Muc5b A G 7: 141,867,717 S4315G probably benign Het
Nlrp1b T A 11: 71,181,347 T557S probably benign Het
Nlrp3 A G 11: 59,565,850 D946G probably benign Het
Obscn T C 11: 58,995,415 probably benign Het
Olfr469 T C 7: 107,823,374 S32G probably benign Het
Olfr509 A G 7: 108,645,658 I306T probably benign Het
Olfr866 A T 9: 20,027,213 S242T probably damaging Het
Pask A T 1: 93,314,339 F1219I probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Plec G A 15: 76,174,080 Q3751* probably null Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sema4a C T 3: 88,448,149 probably benign Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Spag1 G T 15: 36,192,047 K217N probably damaging Het
Ssh1 C T 5: 113,966,731 R9H probably damaging Het
St3gal4 C A 9: 35,053,448 V155F probably damaging Het
Stxbp5 C T 10: 9,809,040 E539K possibly damaging Het
Tbc1d7 G T 13: 43,154,685 probably benign Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Ttc21b T C 2: 66,242,773 I190V probably benign Het
Ttn T C 2: 76,707,047 T34846A probably benign Het
Ube4a A G 9: 44,949,816 V232A possibly damaging Het
Uri1 A T 7: 37,969,675 D122E probably damaging Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zan T A 5: 137,458,639 E1278D unknown Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Actr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Actr2 APN 11 20094370 missense probably benign 0.03
IGL00164:Actr2 APN 11 20080015 splice site probably benign
IGL00566:Actr2 APN 11 20072487 missense possibly damaging 0.92
IGL00822:Actr2 APN 11 20094367 missense probably damaging 1.00
IGL02993:Actr2 APN 11 20072514 missense probably damaging 1.00
IGL03330:Actr2 APN 11 20091330 missense probably benign 0.01
R0092:Actr2 UTSW 11 20094308 missense probably benign 0.00
R0129:Actr2 UTSW 11 20100939 splice site probably benign
R0513:Actr2 UTSW 11 20080124 missense probably damaging 1.00
R0848:Actr2 UTSW 11 20072584 missense probably benign 0.02
R5175:Actr2 UTSW 11 20080114 missense probably benign 0.25
R5364:Actr2 UTSW 11 20100797 intron probably benign
R6544:Actr2 UTSW 11 20100933 missense probably damaging 1.00
R7330:Actr2 UTSW 11 20072544 missense probably damaging 1.00
X0021:Actr2 UTSW 11 20080702 missense probably damaging 0.99
X0066:Actr2 UTSW 11 20080065 missense probably benign 0.00
X0066:Actr2 UTSW 11 20080066 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGCTGTCTATGCCCGACAACC -3'
(R):5'- GGAAATGCTGGCTCTAAGCCTCAC -3'

Sequencing Primer
(F):5'- tctatgcccgacaacctaaac -3'
(R):5'- ACTAGCCACCTTTTTGTGGG -3'
Posted On2013-11-08