Incidental Mutation 'R0863:Gucy1b2'
ID 82219
Institutional Source Beutler Lab
Gene Symbol Gucy1b2
Ensembl Gene ENSMUSG00000021933
Gene Name guanylate cyclase 1, soluble, beta 2
Synonyms
MMRRC Submission 039037-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock # R0863 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 62392676-62456289 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62419062 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 282 (D282G)
Ref Sequence ENSEMBL: ENSMUSP00000022501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022501] [ENSMUST00000128573] [ENSMUST00000165651]
AlphaFold Q8BXH3
Predicted Effect probably benign
Transcript: ENSMUST00000022501
AA Change: D282G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022501
Gene: ENSMUSG00000021933
AA Change: D282G

DomainStartEndE-ValueType
Pfam:HNOB 83 244 6e-60 PFAM
Blast:CYCc 263 362 3e-24 BLAST
PDB:4GJ4|D 350 471 4e-8 PDB
CYCc 513 712 1.11e-108 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128573
SMART Domains Protein: ENSMUSP00000120329
Gene: ENSMUSG00000021933

DomainStartEndE-ValueType
Pfam:HNOB 1 167 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165651
SMART Domains Protein: ENSMUSP00000128114
Gene: ENSMUSG00000021933

DomainStartEndE-ValueType
Pfam:HNOB 82 250 1.1e-53 PFAM
Blast:CYCc 263 347 6e-25 BLAST
PDB:4GJ4|D 335 456 5e-8 PDB
CYCc 498 697 1.11e-108 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 94% (59/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal hyperventilation response to a 10% oxygen environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
2310016G11Rik A G 7: 44,677,808 noncoding transcript Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca14 A T 7: 120,216,230 T234S probably benign Het
Acap1 C A 11: 69,887,056 V119L probably damaging Het
Actr2 C T 11: 20,080,760 V163I probably benign Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Arnt2 T A 7: 84,265,584 K524M probably damaging Het
Brca1 T C 11: 101,524,770 Y846C probably benign Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Cep350 T A 1: 155,862,235 I2621L probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fank1 A G 7: 133,880,623 R73G possibly damaging Het
Fes A T 7: 80,380,886 W552R probably damaging Het
Fsd2 A G 7: 81,542,165 V488A possibly damaging Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gm9493 A T 19: 23,619,809 Q23L probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lonp1 T C 17: 56,618,331 K487R probably damaging Het
Ltbp1 A G 17: 75,252,386 Y290C probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Ms4a10 C T 19: 10,968,593 G58D probably damaging Het
Muc5b A G 7: 141,867,717 S4315G probably benign Het
Nlrp1b T A 11: 71,181,347 T557S probably benign Het
Nlrp3 A G 11: 59,565,850 D946G probably benign Het
Obscn T C 11: 58,995,415 probably benign Het
Olfr469 T C 7: 107,823,374 S32G probably benign Het
Olfr509 A G 7: 108,645,658 I306T probably benign Het
Olfr866 A T 9: 20,027,213 S242T probably damaging Het
Pask A T 1: 93,314,339 F1219I probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Plec G A 15: 76,174,080 Q3751* probably null Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sema4a C T 3: 88,448,149 probably benign Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Spag1 G T 15: 36,192,047 K217N probably damaging Het
Ssh1 C T 5: 113,966,731 R9H probably damaging Het
St3gal4 C A 9: 35,053,448 V155F probably damaging Het
Stxbp5 C T 10: 9,809,040 E539K possibly damaging Het
Tbc1d7 G T 13: 43,154,685 probably benign Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Ttc21b T C 2: 66,242,773 I190V probably benign Het
Ttn T C 2: 76,707,047 T34846A probably benign Het
Ube4a A G 9: 44,949,816 V232A possibly damaging Het
Uri1 A T 7: 37,969,675 D122E probably damaging Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zan T A 5: 137,458,639 E1278D unknown Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Gucy1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Gucy1b2 APN 14 62406245 missense probably damaging 1.00
IGL00465:Gucy1b2 APN 14 62403200 missense probably benign
IGL00756:Gucy1b2 APN 14 62403209 missense probably benign
IGL01800:Gucy1b2 APN 14 62411655 missense probably benign 0.03
IGL01875:Gucy1b2 APN 14 62420146 missense probably damaging 1.00
IGL03033:Gucy1b2 APN 14 62415944 missense probably benign 0.00
IGL03110:Gucy1b2 APN 14 62433834 splice site probably benign
IGL02796:Gucy1b2 UTSW 14 62407694 missense probably benign 0.42
R0183:Gucy1b2 UTSW 14 62419140 missense probably damaging 1.00
R0605:Gucy1b2 UTSW 14 62403159 splice site probably benign
R0815:Gucy1b2 UTSW 14 62419062 missense probably benign 0.00
R0972:Gucy1b2 UTSW 14 62408678 missense possibly damaging 0.88
R0972:Gucy1b2 UTSW 14 62414369 missense possibly damaging 0.61
R1438:Gucy1b2 UTSW 14 62414321 missense probably damaging 0.98
R2011:Gucy1b2 UTSW 14 62408758 missense probably damaging 0.99
R2409:Gucy1b2 UTSW 14 62406179 frame shift probably null
R3692:Gucy1b2 UTSW 14 62404627 missense probably damaging 1.00
R4484:Gucy1b2 UTSW 14 62411589 missense possibly damaging 0.88
R4715:Gucy1b2 UTSW 14 62423017 missense possibly damaging 0.95
R4730:Gucy1b2 UTSW 14 62407759 missense probably damaging 1.00
R4812:Gucy1b2 UTSW 14 62415897 splice site probably null
R4839:Gucy1b2 UTSW 14 62448246 missense probably damaging 1.00
R5261:Gucy1b2 UTSW 14 62404579 missense probably damaging 1.00
R5326:Gucy1b2 UTSW 14 62453330 critical splice donor site probably null
R5656:Gucy1b2 UTSW 14 62422981 missense probably damaging 1.00
R5779:Gucy1b2 UTSW 14 62414301 missense possibly damaging 0.82
R6000:Gucy1b2 UTSW 14 62419050 missense probably benign 0.00
R6274:Gucy1b2 UTSW 14 62415939 missense probably damaging 1.00
R7457:Gucy1b2 UTSW 14 62392952 missense probably benign 0.08
R7487:Gucy1b2 UTSW 14 62448223 missense probably damaging 0.97
R7607:Gucy1b2 UTSW 14 62419177 missense probably damaging 1.00
R8030:Gucy1b2 UTSW 14 62392870 missense probably benign
R8285:Gucy1b2 UTSW 14 62420107 missense probably damaging 0.98
R8287:Gucy1b2 UTSW 14 62411816 missense probably damaging 1.00
R8970:Gucy1b2 UTSW 14 62419215 missense possibly damaging 0.95
RF030:Gucy1b2 UTSW 14 62408641 critical splice donor site probably benign
RF035:Gucy1b2 UTSW 14 62408641 critical splice donor site probably benign
Z1177:Gucy1b2 UTSW 14 62453453 missense unknown
Predicted Primers PCR Primer
(F):5'- AGATCTTACAGCACAAAGTGCAGCC -3'
(R):5'- GATTTTACCCCTGAGCTGGATTCCC -3'

Sequencing Primer
(F):5'- agtgcagcccatcataacc -3'
(R):5'- CATATGATGCCTATCGTGAAGC -3'
Posted On 2013-11-08