Mutagenetix > Incidental Mutations

Incidental Mutation 'R0863:Scel'

82220

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

039037-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0863 (G1)

Quality Score

218

Status

Validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103586480 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 381 (S381R)

Ref Sequence

ENSEMBL: ENSMUSP00000154402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095576
AA Change: S401R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: S401R

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227322
AA Change: S381R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.4%
20x: 94.8%

Validation Efficiency

94% (59/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	A	T	9: 92,351,087	I88L	possibly damaging	Het
2310016G11Rik	A	G	7: 44,677,808		noncoding transcript	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abca14	A	T	7: 120,216,230	T234S	probably benign	Het
Acap1	C	A	11: 69,887,056	V119L	probably damaging	Het
Actr2	C	T	11: 20,080,760	V163I	probably benign	Het
Adcy4	T	C	14: 55,783,599	Y27C	probably damaging	Het
Arnt2	T	A	7: 84,265,584	K524M	probably damaging	Het
Brca1	T	C	11: 101,524,770	Y846C	probably benign	Het
Capn7	T	A	14: 31,369,757	C704S	possibly damaging	Het
Cep350	T	A	1: 155,862,235	I2621L	probably benign	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Cul9	T	C	17: 46,537,822		probably null	Het
Erc2	A	C	14: 28,025,148	N345T	probably benign	Het
Fank1	A	G	7: 133,880,623	R73G	possibly damaging	Het
Fes	A	T	7: 80,380,886	W552R	probably damaging	Het
Fsd2	A	G	7: 81,542,165	V488A	possibly damaging	Het
Gfm1	T	C	3: 67,474,595	S705P	probably damaging	Het
Gm9493	A	T	19: 23,619,809	Q23L	probably benign	Het
Gucy1b2	T	C	14: 62,419,062	D282G	probably benign	Het
H2-Ab1	T	C	17: 34,267,354	I129T	probably damaging	Het
H2-M10.3	T	A	17: 36,366,690	Y232F	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Lonp1	T	C	17: 56,618,331	K487R	probably damaging	Het
Ltbp1	A	G	17: 75,252,386	Y290C	probably damaging	Het
Mgea5	C	T	19: 45,782,986	A49T	probably benign	Het
Ms4a10	C	T	19: 10,968,593	G58D	probably damaging	Het
Muc5b	A	G	7: 141,867,717	S4315G	probably benign	Het
Nlrp1b	T	A	11: 71,181,347	T557S	probably benign	Het
Nlrp3	A	G	11: 59,565,850	D946G	probably benign	Het
Obscn	T	C	11: 58,995,415		probably benign	Het
Olfr469	T	C	7: 107,823,374	S32G	probably benign	Het
Olfr509	A	G	7: 108,645,658	I306T	probably benign	Het
Olfr866	A	T	9: 20,027,213	S242T	probably damaging	Het
Pask	A	T	1: 93,314,339	F1219I	probably damaging	Het
Pcdhb2	G	A	18: 37,295,657	V228I	possibly damaging	Het
Phf1	T	C	17: 26,937,140		probably benign	Het
Plec	G	A	15: 76,174,080	Q3751*	probably null	Het
Ppp1r12c	G	T	7: 4,486,366	Q240K	probably damaging	Het
Ralgapa1	A	T	12: 55,762,681	Y436*	probably null	Het
Ralgapa1	C	A	12: 55,782,777		probably benign	Het
Sema4a	C	T	3: 88,448,149		probably benign	Het
Sltm	A	G	9: 70,561,908	T150A	probably benign	Het
Spag1	G	T	15: 36,192,047	K217N	probably damaging	Het
Ssh1	C	T	5: 113,966,731	R9H	probably damaging	Het
St3gal4	C	A	9: 35,053,448	V155F	probably damaging	Het
Stxbp5	C	T	10: 9,809,040	E539K	possibly damaging	Het
Tbc1d7	G	T	13: 43,154,685		probably benign	Het
Thnsl2	A	T	6: 71,134,224	L220*	probably null	Het
Tinf2	G	A	14: 55,680,109	P308S	probably benign	Het
Tnf	T	C	17: 35,201,144		probably benign	Het
Ttc21b	T	C	2: 66,242,773	I190V	probably benign	Het
Ttn	T	C	2: 76,707,047	T34846A	probably benign	Het
Ube4a	A	G	9: 44,949,816	V232A	possibly damaging	Het
Uri1	A	T	7: 37,969,675	D122E	probably damaging	Het
Vmn2r94	T	G	17: 18,257,711	Q146P	probably damaging	Het
Zan	T	A	5: 137,458,639	E1278D	unknown	Het
Zfhx4	T	A	3: 5,245,315	S919R	possibly damaging	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- CGTGTCTCAATTCTTATGAAGCTCCTCC -3'
(R):5'- TGCCCAGCGATCCTCCACC -3'

Sequencing Primer
(F):5'- cacacacacacactcacac -3'
(R):5'- CTGTACTTAAGACTAAGAGAAGGCCC -3'

Posted On

2013-11-08