Incidental Mutation 'R0863:Scel'
ID82220
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Namesciellin
Synonyms9230114I02Rik
MMRRC Submission 039037-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0863 (G1)
Quality Score218
Status Validated
Chromosome14
Chromosomal Location103513342-103612797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103586480 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 381 (S381R)
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095576
AA Change: S401R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: S401R

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000227322
AA Change: S381R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
2310016G11Rik A G 7: 44,677,808 noncoding transcript Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca14 A T 7: 120,216,230 T234S probably benign Het
Acap1 C A 11: 69,887,056 V119L probably damaging Het
Actr2 C T 11: 20,080,760 V163I probably benign Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Arnt2 T A 7: 84,265,584 K524M probably damaging Het
Brca1 T C 11: 101,524,770 Y846C probably benign Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Cep350 T A 1: 155,862,235 I2621L probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fank1 A G 7: 133,880,623 R73G possibly damaging Het
Fes A T 7: 80,380,886 W552R probably damaging Het
Fsd2 A G 7: 81,542,165 V488A possibly damaging Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gm9493 A T 19: 23,619,809 Q23L probably benign Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lonp1 T C 17: 56,618,331 K487R probably damaging Het
Ltbp1 A G 17: 75,252,386 Y290C probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Ms4a10 C T 19: 10,968,593 G58D probably damaging Het
Muc5b A G 7: 141,867,717 S4315G probably benign Het
Nlrp1b T A 11: 71,181,347 T557S probably benign Het
Nlrp3 A G 11: 59,565,850 D946G probably benign Het
Obscn T C 11: 58,995,415 probably benign Het
Olfr469 T C 7: 107,823,374 S32G probably benign Het
Olfr509 A G 7: 108,645,658 I306T probably benign Het
Olfr866 A T 9: 20,027,213 S242T probably damaging Het
Pask A T 1: 93,314,339 F1219I probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Plec G A 15: 76,174,080 Q3751* probably null Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Sema4a C T 3: 88,448,149 probably benign Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Spag1 G T 15: 36,192,047 K217N probably damaging Het
Ssh1 C T 5: 113,966,731 R9H probably damaging Het
St3gal4 C A 9: 35,053,448 V155F probably damaging Het
Stxbp5 C T 10: 9,809,040 E539K possibly damaging Het
Tbc1d7 G T 13: 43,154,685 probably benign Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Ttc21b T C 2: 66,242,773 I190V probably benign Het
Ttn T C 2: 76,707,047 T34846A probably benign Het
Ube4a A G 9: 44,949,816 V232A possibly damaging Het
Uri1 A T 7: 37,969,675 D122E probably damaging Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zan T A 5: 137,458,639 E1278D unknown Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CGTGTCTCAATTCTTATGAAGCTCCTCC -3'
(R):5'- TGCCCAGCGATCCTCCACC -3'

Sequencing Primer
(F):5'- cacacacacacactcacac -3'
(R):5'- CTGTACTTAAGACTAAGAGAAGGCCC -3'
Posted On2013-11-08