Incidental Mutation 'R0863:Vmn2r94'
ID 82223
Institutional Source Beutler Lab
Gene Symbol Vmn2r94
Ensembl Gene ENSMUSG00000090417
Gene Name vomeronasal 2, receptor 94
Synonyms EG665227
MMRRC Submission 039037-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R0863 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 18240994-18277756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 18257711 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 146 (Q146P)
Ref Sequence ENSEMBL: ENSMUSP00000156288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172190] [ENSMUST00000231457] [ENSMUST00000231815]
AlphaFold E9PZK8
Predicted Effect probably damaging
Transcript: ENSMUST00000172190
AA Change: Q146P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126386
Gene: ENSMUSG00000090417
AA Change: Q146P

DomainStartEndE-ValueType
Pfam:ANF_receptor 42 425 1.7e-35 PFAM
Pfam:NCD3G 469 522 3.5e-21 PFAM
Pfam:7tm_3 553 790 1.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231457
Predicted Effect probably damaging
Transcript: ENSMUST00000231815
AA Change: Q146P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 94% (59/63)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
2310016G11Rik A G 7: 44,677,808 noncoding transcript Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca14 A T 7: 120,216,230 T234S probably benign Het
Acap1 C A 11: 69,887,056 V119L probably damaging Het
Actr2 C T 11: 20,080,760 V163I probably benign Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Arnt2 T A 7: 84,265,584 K524M probably damaging Het
Brca1 T C 11: 101,524,770 Y846C probably benign Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Cep350 T A 1: 155,862,235 I2621L probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fank1 A G 7: 133,880,623 R73G possibly damaging Het
Fes A T 7: 80,380,886 W552R probably damaging Het
Fsd2 A G 7: 81,542,165 V488A possibly damaging Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gm9493 A T 19: 23,619,809 Q23L probably benign Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lonp1 T C 17: 56,618,331 K487R probably damaging Het
Ltbp1 A G 17: 75,252,386 Y290C probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Ms4a10 C T 19: 10,968,593 G58D probably damaging Het
Muc5b A G 7: 141,867,717 S4315G probably benign Het
Nlrp1b T A 11: 71,181,347 T557S probably benign Het
Nlrp3 A G 11: 59,565,850 D946G probably benign Het
Obscn T C 11: 58,995,415 probably benign Het
Olfr469 T C 7: 107,823,374 S32G probably benign Het
Olfr509 A G 7: 108,645,658 I306T probably benign Het
Olfr866 A T 9: 20,027,213 S242T probably damaging Het
Pask A T 1: 93,314,339 F1219I probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Plec G A 15: 76,174,080 Q3751* probably null Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sema4a C T 3: 88,448,149 probably benign Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Spag1 G T 15: 36,192,047 K217N probably damaging Het
Ssh1 C T 5: 113,966,731 R9H probably damaging Het
St3gal4 C A 9: 35,053,448 V155F probably damaging Het
Stxbp5 C T 10: 9,809,040 E539K possibly damaging Het
Tbc1d7 G T 13: 43,154,685 probably benign Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Ttc21b T C 2: 66,242,773 I190V probably benign Het
Ttn T C 2: 76,707,047 T34846A probably benign Het
Ube4a A G 9: 44,949,816 V232A possibly damaging Het
Uri1 A T 7: 37,969,675 D122E probably damaging Het
Zan T A 5: 137,458,639 E1278D unknown Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Vmn2r94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Vmn2r94 APN 17 18257039 missense probably damaging 1.00
IGL01676:Vmn2r94 APN 17 18257010 missense probably benign
IGL01687:Vmn2r94 APN 17 18253312 missense possibly damaging 0.64
IGL02113:Vmn2r94 APN 17 18257675 missense probably damaging 0.99
IGL02408:Vmn2r94 APN 17 18253261 missense probably benign 0.01
IGL02451:Vmn2r94 APN 17 18258191 missense possibly damaging 0.95
IGL02755:Vmn2r94 APN 17 18244499 missense probably benign 0.01
IGL02822:Vmn2r94 APN 17 18243620 missense probably benign 0.00
IGL02868:Vmn2r94 APN 17 18244054 missense possibly damaging 0.75
IGL03008:Vmn2r94 APN 17 18257646 missense probably benign 0.05
R0112:Vmn2r94 UTSW 17 18243604 missense probably benign
R0371:Vmn2r94 UTSW 17 18257294 missense probably benign 0.11
R0413:Vmn2r94 UTSW 17 18243818 missense probably damaging 0.98
R0627:Vmn2r94 UTSW 17 18257165 missense probably damaging 1.00
R0737:Vmn2r94 UTSW 17 18277433 nonsense probably null
R0815:Vmn2r94 UTSW 17 18257711 missense probably damaging 1.00
R1125:Vmn2r94 UTSW 17 18257455 missense probably damaging 1.00
R1276:Vmn2r94 UTSW 17 18257082 missense possibly damaging 0.47
R1491:Vmn2r94 UTSW 17 18257703 missense probably damaging 1.00
R1500:Vmn2r94 UTSW 17 18256980 missense probably benign 0.07
R1610:Vmn2r94 UTSW 17 18243733 missense probably damaging 1.00
R1664:Vmn2r94 UTSW 17 18244144 missense probably damaging 0.99
R1716:Vmn2r94 UTSW 17 18257373 missense probably benign 0.01
R1843:Vmn2r94 UTSW 17 18244470 missense probably benign 0.01
R1882:Vmn2r94 UTSW 17 18244214 missense probably benign 0.07
R1936:Vmn2r94 UTSW 17 18244292 nonsense probably null
R2273:Vmn2r94 UTSW 17 18257331 missense probably benign 0.00
R2508:Vmn2r94 UTSW 17 18257474 missense probably benign 0.32
R3436:Vmn2r94 UTSW 17 18258388 splice site probably benign
R3917:Vmn2r94 UTSW 17 18244358 missense probably benign
R3968:Vmn2r94 UTSW 17 18258385 missense possibly damaging 0.95
R3969:Vmn2r94 UTSW 17 18258385 missense possibly damaging 0.95
R4257:Vmn2r94 UTSW 17 18244171 missense probably damaging 1.00
R4271:Vmn2r94 UTSW 17 18243678 missense probably damaging 1.00
R4349:Vmn2r94 UTSW 17 18244343 missense probably benign 0.01
R4436:Vmn2r94 UTSW 17 18258383 missense probably damaging 1.00
R4603:Vmn2r94 UTSW 17 18257385 missense probably benign 0.33
R4821:Vmn2r94 UTSW 17 18257031 missense probably benign 0.02
R5288:Vmn2r94 UTSW 17 18244466 missense probably damaging 1.00
R5725:Vmn2r94 UTSW 17 18256227 missense possibly damaging 0.88
R5735:Vmn2r94 UTSW 17 18243804 missense probably damaging 1.00
R6066:Vmn2r94 UTSW 17 18257433 missense probably damaging 0.99
R6124:Vmn2r94 UTSW 17 18244059 missense probably benign 0.01
R6189:Vmn2r94 UTSW 17 18257734 missense probably benign 0.25
R6245:Vmn2r94 UTSW 17 18258123 missense probably damaging 1.00
R6574:Vmn2r94 UTSW 17 18256159 missense probably damaging 1.00
R7236:Vmn2r94 UTSW 17 18257549 missense possibly damaging 0.49
R7317:Vmn2r94 UTSW 17 18243620 missense probably benign 0.00
R7398:Vmn2r94 UTSW 17 18257341 missense probably benign 0.00
R7399:Vmn2r94 UTSW 17 18244503 critical splice acceptor site probably null
R7478:Vmn2r94 UTSW 17 18257505 missense probably benign
R8099:Vmn2r94 UTSW 17 18257397 missense probably benign 0.00
R8189:Vmn2r94 UTSW 17 18258356 missense probably damaging 1.00
R8217:Vmn2r94 UTSW 17 18243724 missense probably damaging 1.00
R8303:Vmn2r94 UTSW 17 18244171 missense probably damaging 1.00
R8543:Vmn2r94 UTSW 17 18243722 missense possibly damaging 0.45
R8684:Vmn2r94 UTSW 17 18277650 start gained probably benign
R8889:Vmn2r94 UTSW 17 18244073 missense possibly damaging 0.83
R8892:Vmn2r94 UTSW 17 18244073 missense possibly damaging 0.83
R9282:Vmn2r94 UTSW 17 18277489 missense possibly damaging 0.89
R9526:Vmn2r94 UTSW 17 18256999 missense probably benign
R9647:Vmn2r94 UTSW 17 18243622 missense probably benign 0.00
R9748:Vmn2r94 UTSW 17 18243727 missense probably benign 0.21
R9789:Vmn2r94 UTSW 17 18243776 missense probably damaging 1.00
RF014:Vmn2r94 UTSW 17 18253287 nonsense probably null
X0011:Vmn2r94 UTSW 17 18244448 missense possibly damaging 0.76
X0028:Vmn2r94 UTSW 17 18243975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCATGACCCAGACAATCCATGTCAA -3'
(R):5'- GCCCAAATTGGGACATTGCTTCAAC -3'

Sequencing Primer
(F):5'- CCAGAAGCTTGTAAAATATGCAGTCC -3'
(R):5'- CTGAGCAAGTCCTTGAAACTTAC -3'
Posted On 2013-11-08