Mutagenetix > Incidental Mutations

Incidental Mutation 'R0863:Mgea5'

82234

Institutional Source

Beutler Lab

Gene Symbol

Mgea5

Ensembl Gene

ENSMUSG00000025220

Gene Name

meningioma expressed antigen 5 (hyaluronidase)

Synonyms

2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik

MMRRC Submission

039037-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0863 (G1)

Quality Score

120

Status

Validated

Chromosome

Chromosomal Location

45750261-45783520 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 45782986 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 49 (A49T)

Ref Sequence

ENSEMBL: ENSMUSP00000026243 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026243]

Predicted Effect

probably benign
Transcript: ENSMUST00000026243
AA Change: A49T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: A49T

Domain	Start	End	E-Value	Type
low complexity region	44	57	N/A	INTRINSIC
Pfam:NAGidase	62	361	2.5e-84	PFAM
low complexity region	453	458	N/A	INTRINSIC
PDB:4BMH\|A	700	915	1e-13	PDB
SCOP:d1cjwa_	715	916	1e-3	SMART

Meta Mutation Damage Score

0.1012

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.4%
20x: 94.8%

Validation Efficiency

94% (59/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	A	T	9: 92,351,087	I88L	possibly damaging	Het
2310016G11Rik	A	G	7: 44,677,808		noncoding transcript	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abca14	A	T	7: 120,216,230	T234S	probably benign	Het
Acap1	C	A	11: 69,887,056	V119L	probably damaging	Het
Actr2	C	T	11: 20,080,760	V163I	probably benign	Het
Adcy4	T	C	14: 55,783,599	Y27C	probably damaging	Het
Arnt2	T	A	7: 84,265,584	K524M	probably damaging	Het
Brca1	T	C	11: 101,524,770	Y846C	probably benign	Het
Capn7	T	A	14: 31,369,757	C704S	possibly damaging	Het
Cep350	T	A	1: 155,862,235	I2621L	probably benign	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Cul9	T	C	17: 46,537,822		probably null	Het
Erc2	A	C	14: 28,025,148	N345T	probably benign	Het
Fank1	A	G	7: 133,880,623	R73G	possibly damaging	Het
Fes	A	T	7: 80,380,886	W552R	probably damaging	Het
Fsd2	A	G	7: 81,542,165	V488A	possibly damaging	Het
Gfm1	T	C	3: 67,474,595	S705P	probably damaging	Het
Gm9493	A	T	19: 23,619,809	Q23L	probably benign	Het
Gucy1b2	T	C	14: 62,419,062	D282G	probably benign	Het
H2-Ab1	T	C	17: 34,267,354	I129T	probably damaging	Het
H2-M10.3	T	A	17: 36,366,690	Y232F	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Lonp1	T	C	17: 56,618,331	K487R	probably damaging	Het
Ltbp1	A	G	17: 75,252,386	Y290C	probably damaging	Het
Ms4a10	C	T	19: 10,968,593	G58D	probably damaging	Het
Muc5b	A	G	7: 141,867,717	S4315G	probably benign	Het
Nlrp1b	T	A	11: 71,181,347	T557S	probably benign	Het
Nlrp3	A	G	11: 59,565,850	D946G	probably benign	Het
Obscn	T	C	11: 58,995,415		probably benign	Het
Olfr469	T	C	7: 107,823,374	S32G	probably benign	Het
Olfr509	A	G	7: 108,645,658	I306T	probably benign	Het
Olfr866	A	T	9: 20,027,213	S242T	probably damaging	Het
Pask	A	T	1: 93,314,339	F1219I	probably damaging	Het
Pcdhb2	G	A	18: 37,295,657	V228I	possibly damaging	Het
Phf1	T	C	17: 26,937,140		probably benign	Het
Plec	G	A	15: 76,174,080	Q3751*	probably null	Het
Ppp1r12c	G	T	7: 4,486,366	Q240K	probably damaging	Het
Ralgapa1	A	T	12: 55,762,681	Y436*	probably null	Het
Ralgapa1	C	A	12: 55,782,777		probably benign	Het
Scel	T	A	14: 103,586,480	S381R	possibly damaging	Het
Sema4a	C	T	3: 88,448,149		probably benign	Het
Sltm	A	G	9: 70,561,908	T150A	probably benign	Het
Spag1	G	T	15: 36,192,047	K217N	probably damaging	Het
Ssh1	C	T	5: 113,966,731	R9H	probably damaging	Het
St3gal4	C	A	9: 35,053,448	V155F	probably damaging	Het
Stxbp5	C	T	10: 9,809,040	E539K	possibly damaging	Het
Tbc1d7	G	T	13: 43,154,685		probably benign	Het
Thnsl2	A	T	6: 71,134,224	L220*	probably null	Het
Tinf2	G	A	14: 55,680,109	P308S	probably benign	Het
Tnf	T	C	17: 35,201,144		probably benign	Het
Ttc21b	T	C	2: 66,242,773	I190V	probably benign	Het
Ttn	T	C	2: 76,707,047	T34846A	probably benign	Het
Ube4a	A	G	9: 44,949,816	V232A	possibly damaging	Het
Uri1	A	T	7: 37,969,675	D122E	probably damaging	Het
Vmn2r94	T	G	17: 18,257,711	Q146P	probably damaging	Het
Zan	T	A	5: 137,458,639	E1278D	unknown	Het
Zfhx4	T	A	3: 5,245,315	S919R	possibly damaging	Het

Other mutations in Mgea5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00671:Mgea5	APN	19	45765540	missense	possibly damaging	0.89
IGL01845:Mgea5	APN	19	45767862	missense	probably benign	0.00
IGL02039:Mgea5	APN	19	45773703	missense	probably damaging	0.98
IGL02428:Mgea5	APN	19	45765501	missense	probably damaging	1.00
IGL02581:Mgea5	APN	19	45752191	missense	possibly damaging	0.53
IGL02971:Mgea5	APN	19	45762243	missense	probably damaging	1.00
R0127:Mgea5	UTSW	19	45771888	missense	probably damaging	1.00
R0815:Mgea5	UTSW	19	45782986	missense	probably benign	0.00
R1127:Mgea5	UTSW	19	45752155	nonsense	probably null
R1501:Mgea5	UTSW	19	45778640	missense	probably null	1.00
R1514:Mgea5	UTSW	19	45776931	missense	probably damaging	1.00
R1586:Mgea5	UTSW	19	45776910	missense	possibly damaging	0.94
R1716:Mgea5	UTSW	19	45752174	missense	probably benign	0.35
R1755:Mgea5	UTSW	19	45758406	missense	possibly damaging	0.93
R1774:Mgea5	UTSW	19	45776984	missense	probably benign	0.37
R2152:Mgea5	UTSW	19	45758022	nonsense	probably null
R4403:Mgea5	UTSW	19	45778639	missense	probably damaging	1.00
R4664:Mgea5	UTSW	19	45771945	missense	probably benign	0.15
R4971:Mgea5	UTSW	19	45770046	splice site	probably null
R5377:Mgea5	UTSW	19	45758022	nonsense	probably null
R5571:Mgea5	UTSW	19	45777006	missense	probably benign
R5639:Mgea5	UTSW	19	45776999	missense	probably damaging	1.00
R5665:Mgea5	UTSW	19	45776997	missense	probably benign	0.00
R5776:Mgea5	UTSW	19	45771924	missense	probably damaging	1.00
R6050:Mgea5	UTSW	19	45765480	missense	possibly damaging	0.95
R6054:Mgea5	UTSW	19	45776132	missense	probably damaging	1.00
R6317:Mgea5	UTSW	19	45771680	critical splice donor site	probably null
R6410:Mgea5	UTSW	19	45776045	splice site	probably null
R6990:Mgea5	UTSW	19	45767476	missense	probably benign	0.00
R7103:Mgea5	UTSW	19	45783166	start gained	probably benign
R7340:Mgea5	UTSW	19	45767456	nonsense	probably null
R7437:Mgea5	UTSW	19	45778607	missense	possibly damaging	0.76
R7490:Mgea5	UTSW	19	45767447	nonsense	probably null
R7741:Mgea5	UTSW	19	45776062	missense	probably damaging	1.00
R7823:Mgea5	UTSW	19	45776915	missense	possibly damaging	0.51
R8017:Mgea5	UTSW	19	45773668	missense	probably damaging	1.00
R8019:Mgea5	UTSW	19	45773668	missense	probably damaging	1.00
R8066:Mgea5	UTSW	19	45771852	missense	probably damaging	0.99
R8075:Mgea5	UTSW	19	45761182	missense	probably damaging	0.97
R8172:Mgea5	UTSW	19	45776900	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGAGCAATGACGGACGCCTC -3'
(R):5'- GGCTTATCCCAAGGAAAGGCGG -3'

Sequencing Primer
(F):5'- TGGAAGGCCAACTCACCTT -3'
(R):5'- gagaggaagggggaaggg -3'

Posted On

2013-11-08