Mutagenetix > Incidental Mutations

Incidental Mutation 'R0864:D430041D05Rik'

82241

Institutional Source

Beutler Lab

Gene Symbol

D430041D05Rik

Ensembl Gene

ENSMUSG00000068373

Gene Name

RIKEN cDNA D430041D05 gene

Synonyms

MMRRC Submission

039038-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R0864 (G1)

Quality Score

212

Status

Validated

Chromosome

Chromosomal Location

104143073-104411013 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 104230428 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1374 (P1374S)

Ref Sequence

ENSEMBL: ENSMUSP00000155485 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089726] [ENSMUST00000136156] [ENSMUST00000141159] [ENSMUST00000230671]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089726
AA Change: P690S

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106756
Gene: ENSMUSG00000068373
AA Change: P690S

Domain	Start	End	E-Value	Type
low complexity region	55	70	N/A	INTRINSIC
low complexity region	206	215	N/A	INTRINSIC
low complexity region	218	230	N/A	INTRINSIC
low complexity region	234	253	N/A	INTRINSIC
Pfam:DUF3827	498	1134	2.4e-282	PFAM
low complexity region	1196	1217	N/A	INTRINSIC
low complexity region	1331	1351	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136156
AA Change: P690S

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000141159
AA Change: P575S

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117041
Gene: ENSMUSG00000068373
AA Change: P575S

Domain	Start	End	E-Value	Type
low complexity region	55	70	N/A	INTRINSIC
low complexity region	91	100	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	119	138	N/A	INTRINSIC
Pfam:DUF3827	383	1020	8.2e-280	PFAM
low complexity region	1082	1103	N/A	INTRINSIC
low complexity region	1217	1237	N/A	INTRINSIC
low complexity region	1246	1258	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149165

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156278

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158981

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230671
AA Change: P1374S

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

Meta Mutation Damage Score

0.0938

Coding Region Coverage

1x: 99.8%
3x: 99.1%
10x: 97.3%
20x: 93.8%

Validation Efficiency

93% (39/42)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr2a	A	G	2: 48,894,786		probably benign	Het
Alx4	A	G	2: 93,642,855	Y66C	probably damaging	Het
Apol7e	T	A	15: 77,717,793	V197E	probably damaging	Het
Chac1	C	A	2: 119,353,469	A184E	probably damaging	Het
Clmn	G	A	12: 104,790,015	T192I	possibly damaging	Het
Csmd1	T	A	8: 16,190,026	Y1124F	probably damaging	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Dyrk4	T	C	6: 126,877,333	E499G	possibly damaging	Het
Fat1	T	A	8: 45,018,037	I1603N	probably damaging	Het
Fbn1	A	T	2: 125,342,891	C1660*	probably null	Het
Gapt	G	C	13: 110,353,739	T130R	probably damaging	Het
Hpn	T	C	7: 31,109,001	I41V	probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Map4	A	G	9: 109,978,969	Y34C	probably damaging	Het
Mapk8	C	T	14: 33,392,992	R189H	probably damaging	Het
Mprip	T	C	11: 59,758,761	V1097A	probably benign	Het
Msh2	A	G	17: 87,680,052	T207A	probably benign	Het
Muc4	A	G	16: 32,752,002	S627G	probably benign	Het
Nbeal2	G	A	9: 110,628,195	T2266I	probably damaging	Het
Pdcd6ip	A	T	9: 113,674,510		probably benign	Het
Pdk2	A	G	11: 95,027,933	Y339H	probably damaging	Het
Piwil2	T	C	14: 70,395,374	D583G	probably benign	Het
Plin4	T	A	17: 56,103,966	M1022L	probably benign	Het
Pmpca	G	A	2: 26,393,209		probably null	Het
Rbbp4	G	T	4: 129,320,551		probably benign	Het
Rbbp8	G	A	18: 11,732,184		probably benign	Het
Rbms3	A	T	9: 117,629,792		probably benign	Het
Snx14	A	T	9: 88,383,996	S726T	possibly damaging	Het
Supt4a	T	A	11: 87,743,087	S88T	probably benign	Het
Tmem245	G	T	4: 56,890,837	H321Q	probably damaging	Het
Trim43c	A	T	9: 88,843,034	H202L	probably benign	Het
Trip12	A	G	1: 84,744,009	F1334S	probably damaging	Het
Vmn1r36	T	C	6: 66,716,856	T12A	probably null	Het
Ywhae	T	G	11: 75,759,430		probably null	Het
Zc3h4	T	A	7: 16,420,179	S131T	probably damaging	Het
Zfp280b	C	T	10: 76,038,305	T6M	probably benign	Het

Other mutations in D430041D05Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:D430041D05Rik	APN	2	104201303	missense	probably damaging	1.00
IGL01114:D430041D05Rik	APN	2	104258166	nonsense	probably null
IGL01669:D430041D05Rik	APN	2	104254961	missense	probably damaging	1.00
IGL02015:D430041D05Rik	APN	2	104230404	missense	probably damaging	1.00
IGL02037:D430041D05Rik	APN	2	104208214	splice site	probably benign
IGL02268:D430041D05Rik	APN	2	104241155	missense	possibly damaging	0.80
IGL02294:D430041D05Rik	APN	2	104255006	missense	probably benign	0.42
IGL02457:D430041D05Rik	APN	2	104249345	missense	probably damaging	0.99
IGL02601:D430041D05Rik	APN	2	104230286	missense	probably damaging	0.99
IGL02647:D430041D05Rik	APN	2	104248266	missense	probably damaging	1.00
IGL02679:D430041D05Rik	APN	2	104230305	missense	possibly damaging	0.80
IGL02926:D430041D05Rik	APN	2	104214259	missense	probably damaging	1.00
IGL03171:D430041D05Rik	APN	2	104241163	missense	possibly damaging	0.95
IGL03178:D430041D05Rik	APN	2	104221211	missense	probably damaging	1.00
IGL03371:D430041D05Rik	APN	2	104248374	missense	probably damaging	1.00
R0027:D430041D05Rik	UTSW	2	104255044	missense	probably benign
R0064:D430041D05Rik	UTSW	2	104249157	missense	probably damaging	1.00
R0135:D430041D05Rik	UTSW	2	104255034	missense	possibly damaging	0.60
R0227:D430041D05Rik	UTSW	2	104205200	missense	possibly damaging	0.85
R0265:D430041D05Rik	UTSW	2	104167950	missense	probably damaging	1.00
R0268:D430041D05Rik	UTSW	2	104167950	missense	probably damaging	1.00
R0282:D430041D05Rik	UTSW	2	104201244	missense	probably damaging	1.00
R0366:D430041D05Rik	UTSW	2	104255340	missense	probably damaging	0.99
R0402:D430041D05Rik	UTSW	2	104168164	missense	probably damaging	0.99
R0436:D430041D05Rik	UTSW	2	104167950	missense	probably damaging	1.00
R0441:D430041D05Rik	UTSW	2	104167947	missense	probably damaging	1.00
R0540:D430041D05Rik	UTSW	2	104233445	missense	probably damaging	1.00
R0607:D430041D05Rik	UTSW	2	104233445	missense	probably damaging	1.00
R0613:D430041D05Rik	UTSW	2	104167950	missense	probably damaging	1.00
R0626:D430041D05Rik	UTSW	2	104167950	missense	probably damaging	1.00
R0747:D430041D05Rik	UTSW	2	104230306	missense	probably damaging	1.00
R0980:D430041D05Rik	UTSW	2	104249345	missense	probably damaging	0.99
R1014:D430041D05Rik	UTSW	2	104258329	missense	possibly damaging	0.94
R1254:D430041D05Rik	UTSW	2	104201303	missense	probably damaging	1.00
R1364:D430041D05Rik	UTSW	2	104155018	missense	possibly damaging	0.93
R1456:D430041D05Rik	UTSW	2	104208083	missense	probably damaging	1.00
R1574:D430041D05Rik	UTSW	2	104221208	small deletion	probably benign
R1604:D430041D05Rik	UTSW	2	104205142	missense	probably damaging	1.00
R1605:D430041D05Rik	UTSW	2	104255570	missense	possibly damaging	0.46
R1623:D430041D05Rik	UTSW	2	104152963	missense	probably damaging	1.00
R1634:D430041D05Rik	UTSW	2	104221211	missense	probably damaging	1.00
R1834:D430041D05Rik	UTSW	2	104168101	missense	probably damaging	1.00
R1885:D430041D05Rik	UTSW	2	104230455	missense	probably benign	0.39
R2080:D430041D05Rik	UTSW	2	104156816	missense	probably damaging	1.00
R2101:D430041D05Rik	UTSW	2	104148830	missense	probably damaging	1.00
R2240:D430041D05Rik	UTSW	2	104156816	missense	probably damaging	1.00
R2923:D430041D05Rik	UTSW	2	104255315	missense	possibly damaging	0.94
R3751:D430041D05Rik	UTSW	2	104255058	missense	possibly damaging	0.94
R3862:D430041D05Rik	UTSW	2	104214177	missense	possibly damaging	0.54
R3863:D430041D05Rik	UTSW	2	104214177	missense	possibly damaging	0.54
R3864:D430041D05Rik	UTSW	2	104214177	missense	possibly damaging	0.54
R3949:D430041D05Rik	UTSW	2	104257368	missense	probably benign	0.02
R4493:D430041D05Rik	UTSW	2	104256339	missense	probably benign	0.02
R4526:D430041D05Rik	UTSW	2	104192433	critical splice donor site	probably null
R4592:D430041D05Rik	UTSW	2	104233479	missense	possibly damaging	0.89
R4598:D430041D05Rik	UTSW	2	104208183	missense	probably damaging	0.99
R4599:D430041D05Rik	UTSW	2	104208183	missense	probably damaging	0.99
R4647:D430041D05Rik	UTSW	2	104258443	missense	probably damaging	0.99
R4765:D430041D05Rik	UTSW	2	104214096	missense	probably damaging	1.00
R4808:D430041D05Rik	UTSW	2	104201110	critical splice donor site	probably null
R4868:D430041D05Rik	UTSW	2	104255409	missense	possibly damaging	0.73
R4982:D430041D05Rik	UTSW	2	104255387	missense	possibly damaging	0.46
R5144:D430041D05Rik	UTSW	2	104258502	missense	probably damaging	0.99
R5255:D430041D05Rik	UTSW	2	104256600	missense	probably benign	0.26
R5356:D430041D05Rik	UTSW	2	104255409	missense	probably damaging	0.99
R5368:D430041D05Rik	UTSW	2	104248284	missense	probably damaging	0.99
R5963:D430041D05Rik	UTSW	2	104248285	missense	possibly damaging	0.66
R5993:D430041D05Rik	UTSW	2	104168067	missense	probably damaging	1.00
R6122:D430041D05Rik	UTSW	2	104256292	missense	probably benign	0.01
R6410:D430041D05Rik	UTSW	2	104168203	splice site	probably null
R6804:D430041D05Rik	UTSW	2	104149026	missense	possibly damaging	0.85
R6850:D430041D05Rik	UTSW	2	104201259	missense	probably damaging	1.00
R6853:D430041D05Rik	UTSW	2	104241155	missense	probably damaging	1.00
R7034:D430041D05Rik	UTSW	2	104192538	missense	probably damaging	0.99
R7146:D430041D05Rik	UTSW	2	104258353	missense	probably benign	0.06
R7250:D430041D05Rik	UTSW	2	104256616	missense	possibly damaging	0.92
R7251:D430041D05Rik	UTSW	2	104221166	missense	probably damaging	1.00
R7313:D430041D05Rik	UTSW	2	104255565	missense	probably benign
R7359:D430041D05Rik	UTSW	2	104214137	missense	probably damaging	1.00
R7361:D430041D05Rik	UTSW	2	104255018	missense	possibly damaging	0.46
R7436:D430041D05Rik	UTSW	2	104257102	missense	probably benign	0.02
R7472:D430041D05Rik	UTSW	2	104410139	missense	unknown
R7492:D430041D05Rik	UTSW	2	104201305	missense	probably damaging	1.00
R7631:D430041D05Rik	UTSW	2	104149018	nonsense	probably null
R7672:D430041D05Rik	UTSW	2	104241236	missense	probably benign	0.01
R7721:D430041D05Rik	UTSW	2	104258529	missense	probably benign	0.00
R7754:D430041D05Rik	UTSW	2	104257159	missense	probably benign	0.01
X0024:D430041D05Rik	UTSW	2	104192566	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGAGACTCCTTACGGTCAGCTTG -3'
(R):5'- CAGATGTTGCTGTTTTCCAACACCC -3'

Sequencing Primer
(F):5'- CTCCTTACGGTCAGCTTGTAGAAG -3'
(R):5'- ACAAGCTTCCTGGAACTGTG -3'

Posted On

2013-11-08