Mutagenetix > Incidental Mutation

Incidental Mutation 'R0864:Mapk8'

82266

Institutional Source

Beutler Lab

Gene Symbol

Mapk8

Ensembl Gene

ENSMUSG00000021936

Gene Name

mitogen-activated protein kinase 8

Synonyms

c-Jun N-terminal kinase, Prkm8, JNK1

MMRRC Submission

039038-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.743) question?

Stock #

R0864 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33099855-33169115 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 33114949 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 189 (R189H)

Ref Sequence

ENSEMBL: ENSMUSP00000107575 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022504] [ENSMUST00000111942] [ENSMUST00000111943] [ENSMUST00000111944] [ENSMUST00000111945] [ENSMUST00000226798]

AlphaFold

Q91Y86

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022504
AA Change: R189H

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000022504
Gene: ENSMUSG00000021936
AA Change: R189H

Domain	Start	End	E-Value	Type
S_TKc	26	321	1.3e-86	SMART
low complexity region	390	403	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111942
AA Change: R189H

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107573
Gene: ENSMUSG00000021936
AA Change: R189H

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	208	1.8e-25	PFAM
Pfam:Pkinase	26	210	5.2e-48	PFAM
Pfam:Kdo	33	178	6.4e-9	PFAM
SCOP:d1pme__	216	286	2e-17	SMART
PDB:3GP0\|A	218	288	4e-11	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000111943
AA Change: R189H

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000107574
Gene: ENSMUSG00000021936
AA Change: R189H

Domain	Start	End	E-Value	Type
S_TKc	26	321	1.3e-86	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111944
AA Change: R189H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107575
Gene: ENSMUSG00000021936
AA Change: R189H

Domain	Start	End	E-Value	Type
S_TKc	26	321	1.06e-86	SMART
low complexity region	390	403	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111945
AA Change: R189H

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107576
Gene: ENSMUSG00000021936
AA Change: R189H

Domain	Start	End	E-Value	Type
S_TKc	26	321	1.06e-86	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127143

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130539

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150659

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227306

Predicted Effect

probably benign
Transcript: ENSMUST00000226798

Meta Mutation Damage Score

0.8392

Coding Region Coverage

1x: 99.8%
3x: 99.1%
10x: 97.3%
20x: 93.8%

Validation Efficiency

93% (39/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal T cell differentiation and proliferation, cardiac morphology and physiology, and chemically-induced tumorigenesis. Mice homozygous for another knock-out allele exhibit abnormal glucose homeostasis and T cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr2a	A	G	2: 48,784,798 (GRCm39)		probably benign	Het
Alx4	A	G	2: 93,473,200 (GRCm39)	Y66C	probably damaging	Het
Apol7e	T	A	15: 77,601,993 (GRCm39)	V197E	probably damaging	Het
Chac1	C	A	2: 119,183,950 (GRCm39)	A184E	probably damaging	Het
Clmn	G	A	12: 104,756,274 (GRCm39)	T192I	possibly damaging	Het
Csmd1	T	A	8: 16,240,040 (GRCm39)	Y1124F	probably damaging	Het
Ctnnbl1	C	T	2: 157,641,337 (GRCm39)		probably benign	Het
D430041D05Rik	G	A	2: 104,060,773 (GRCm39)	P1374S	possibly damaging	Het
Dyrk4	T	C	6: 126,854,296 (GRCm39)	E499G	possibly damaging	Het
Fat1	T	A	8: 45,471,074 (GRCm39)	I1603N	probably damaging	Het
Fbn1	A	T	2: 125,184,811 (GRCm39)	C1660*	probably null	Het
Gapt	G	C	13: 110,490,273 (GRCm39)	T130R	probably damaging	Het
Hpn	T	C	7: 30,808,426 (GRCm39)	I41V	probably benign	Het
Iqca1	C	A	1: 90,070,453 (GRCm39)	G133V	probably null	Het
Map4	A	G	9: 109,808,037 (GRCm39)	Y34C	probably damaging	Het
Mprip	T	C	11: 59,649,587 (GRCm39)	V1097A	probably benign	Het
Msh2	A	G	17: 87,987,480 (GRCm39)	T207A	probably benign	Het
Muc4	A	G	16: 32,570,820 (GRCm39)	S627G	probably benign	Het
Nbeal2	G	A	9: 110,457,263 (GRCm39)	T2266I	probably damaging	Het
Pdcd6ip	A	T	9: 113,503,578 (GRCm39)		probably benign	Het
Pdk2	A	G	11: 94,918,759 (GRCm39)	Y339H	probably damaging	Het
Piwil2	T	C	14: 70,632,823 (GRCm39)	D583G	probably benign	Het
Plin4	T	A	17: 56,410,966 (GRCm39)	M1022L	probably benign	Het
Pmpca	G	A	2: 26,283,221 (GRCm39)		probably null	Het
Rbbp4	G	T	4: 129,214,344 (GRCm39)		probably benign	Het
Rbbp8	G	A	18: 11,865,241 (GRCm39)		probably benign	Het
Rbms3	A	T	9: 117,458,860 (GRCm39)		probably benign	Het
Snx14	A	T	9: 88,266,049 (GRCm39)	S726T	possibly damaging	Het
Supt4a	T	A	11: 87,633,913 (GRCm39)	S88T	probably benign	Het
Tmem245	G	T	4: 56,890,837 (GRCm39)	H321Q	probably damaging	Het
Trim43c	A	T	9: 88,725,087 (GRCm39)	H202L	probably benign	Het
Trip12	A	G	1: 84,721,730 (GRCm39)	F1334S	probably damaging	Het
Vmn1r36	T	C	6: 66,693,840 (GRCm39)	T12A	probably null	Het
Ywhae	T	G	11: 75,650,256 (GRCm39)		probably null	Het
Zc3h4	T	A	7: 16,154,104 (GRCm39)	S131T	probably damaging	Het
Zfp280b	C	T	10: 75,874,139 (GRCm39)	T6M	probably benign	Het

Other mutations in Mapk8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01478:Mapk8	APN	14	33,105,857 (GRCm39)	missense	probably benign	0.01
daughter	UTSW	14	33,112,686 (GRCm39)	missense	probably damaging	1.00
son	UTSW	14	33,124,615 (GRCm39)	missense	probably damaging	1.00
R0255:Mapk8	UTSW	14	33,109,264 (GRCm39)	splice site	probably benign
R0401:Mapk8	UTSW	14	33,104,165 (GRCm39)	missense	probably benign	0.37
R0862:Mapk8	UTSW	14	33,114,949 (GRCm39)	missense	probably damaging	0.98
R1084:Mapk8	UTSW	14	33,110,760 (GRCm39)	nonsense	probably null
R1637:Mapk8	UTSW	14	33,132,919 (GRCm39)	missense	probably benign	0.00
R2038:Mapk8	UTSW	14	33,110,893 (GRCm39)	nonsense	probably null
R3959:Mapk8	UTSW	14	33,104,210 (GRCm39)	missense	probably null	0.21
R4087:Mapk8	UTSW	14	33,112,205 (GRCm39)	missense	probably benign	0.00
R4181:Mapk8	UTSW	14	33,104,177 (GRCm39)	missense	probably damaging	1.00
R4183:Mapk8	UTSW	14	33,104,177 (GRCm39)	missense	probably damaging	1.00
R4184:Mapk8	UTSW	14	33,104,177 (GRCm39)	missense	probably damaging	1.00
R5366:Mapk8	UTSW	14	33,112,686 (GRCm39)	missense	probably damaging	1.00
R6076:Mapk8	UTSW	14	33,112,250 (GRCm39)	missense	probably damaging	1.00
R6991:Mapk8	UTSW	14	33,132,841 (GRCm39)	missense	possibly damaging	0.82
R7345:Mapk8	UTSW	14	33,130,068 (GRCm39)	missense	probably damaging	0.99
R7814:Mapk8	UTSW	14	33,132,834 (GRCm39)	nonsense	probably null
R8194:Mapk8	UTSW	14	33,104,241 (GRCm39)	missense	probably benign
R8550:Mapk8	UTSW	14	33,124,615 (GRCm39)	missense	probably damaging	1.00
Z1176:Mapk8	UTSW	14	33,132,843 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCATGCTTTCCCAAACATTCACGG -3'
(R):5'- GGGTTTGCCTATGGTAAGGAACCTC -3'

Sequencing Primer
(F):5'- GGCAAAACGTTCAAATCCTGG -3'
(R):5'- CAGTGGTCCTGCAGACTATGTA -3'

Posted On

2013-11-08