Incidental Mutation 'R0864:Apol7e'
ID82268
Institutional Source Beutler Lab
Gene Symbol Apol7e
Ensembl Gene ENSMUSG00000071716
Gene Nameapolipoprotein L 7e
SynonymsENSMUSG00000071716
MMRRC Submission 039038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0864 (G1)
Quality Score213
Status Validated
Chromosome15
Chromosomal Location77698857-77719285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77717793 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 197 (V197E)
Ref Sequence ENSEMBL: ENSMUSP00000094085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096358]
Predicted Effect probably damaging
Transcript: ENSMUST00000096358
AA Change: V197E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094085
Gene: ENSMUSG00000071716
AA Change: V197E

DomainStartEndE-ValueType
Pfam:ApoL 20 82 2.3e-14 PFAM
Pfam:ApoL 77 367 6.9e-121 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230236
Meta Mutation Damage Score 0.6512 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 93.8%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,894,786 probably benign Het
Alx4 A G 2: 93,642,855 Y66C probably damaging Het
Chac1 C A 2: 119,353,469 A184E probably damaging Het
Clmn G A 12: 104,790,015 T192I possibly damaging Het
Csmd1 T A 8: 16,190,026 Y1124F probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
D430041D05Rik G A 2: 104,230,428 P1374S possibly damaging Het
Dyrk4 T C 6: 126,877,333 E499G possibly damaging Het
Fat1 T A 8: 45,018,037 I1603N probably damaging Het
Fbn1 A T 2: 125,342,891 C1660* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Hpn T C 7: 31,109,001 I41V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Map4 A G 9: 109,978,969 Y34C probably damaging Het
Mapk8 C T 14: 33,392,992 R189H probably damaging Het
Mprip T C 11: 59,758,761 V1097A probably benign Het
Msh2 A G 17: 87,680,052 T207A probably benign Het
Muc4 A G 16: 32,752,002 S627G probably benign Het
Nbeal2 G A 9: 110,628,195 T2266I probably damaging Het
Pdcd6ip A T 9: 113,674,510 probably benign Het
Pdk2 A G 11: 95,027,933 Y339H probably damaging Het
Piwil2 T C 14: 70,395,374 D583G probably benign Het
Plin4 T A 17: 56,103,966 M1022L probably benign Het
Pmpca G A 2: 26,393,209 probably null Het
Rbbp4 G T 4: 129,320,551 probably benign Het
Rbbp8 G A 18: 11,732,184 probably benign Het
Rbms3 A T 9: 117,629,792 probably benign Het
Snx14 A T 9: 88,383,996 S726T possibly damaging Het
Supt4a T A 11: 87,743,087 S88T probably benign Het
Tmem245 G T 4: 56,890,837 H321Q probably damaging Het
Trim43c A T 9: 88,843,034 H202L probably benign Het
Trip12 A G 1: 84,744,009 F1334S probably damaging Het
Vmn1r36 T C 6: 66,716,856 T12A probably null Het
Ywhae T G 11: 75,759,430 probably null Het
Zc3h4 T A 7: 16,420,179 S131T probably damaging Het
Zfp280b C T 10: 76,038,305 T6M probably benign Het
Other mutations in Apol7e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Apol7e APN 15 77714348 critical splice acceptor site probably null
R1467:Apol7e UTSW 15 77717766 missense probably damaging 1.00
R1467:Apol7e UTSW 15 77717766 missense probably damaging 1.00
R1585:Apol7e UTSW 15 77717829 missense probably damaging 0.99
R1897:Apol7e UTSW 15 77717894 missense probably benign
R2047:Apol7e UTSW 15 77717610 missense probably benign 0.06
R2311:Apol7e UTSW 15 77718036 missense probably benign 0.14
R2895:Apol7e UTSW 15 77714467 missense possibly damaging 0.65
R3809:Apol7e UTSW 15 77718062 missense probably benign 0.05
R3842:Apol7e UTSW 15 77717589 missense probably damaging 1.00
R5351:Apol7e UTSW 15 77718311 makesense probably null
R5629:Apol7e UTSW 15 77718076 missense probably benign 0.08
R5853:Apol7e UTSW 15 77714467 missense probably benign
R5882:Apol7e UTSW 15 77718247 missense probably benign
R6337:Apol7e UTSW 15 77714382 missense possibly damaging 0.80
R6826:Apol7e UTSW 15 77718291 missense probably damaging 0.99
R7422:Apol7e UTSW 15 77714352 nonsense probably null
R7458:Apol7e UTSW 15 77714404 missense probably benign 0.20
R7470:Apol7e UTSW 15 77717943 missense probably benign
R7492:Apol7e UTSW 15 77717456 missense possibly damaging 0.95
R8005:Apol7e UTSW 15 77718077 nonsense probably null
R8119:Apol7e UTSW 15 77717756 missense probably damaging 1.00
R8190:Apol7e UTSW 15 77717807 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TTGGATGCTTATCCTCGGGTGAAAC -3'
(R):5'- GCAGTACCTCCAAAGGCTTCCTTC -3'

Sequencing Primer
(F):5'- CTTATCCTCGGGTGAAACTGGAG -3'
(R):5'- CTTAGCATTAGTTACTAGGCTAGGG -3'
Posted On2013-11-08