Mutagenetix > Incidental Mutation

Incidental Mutation 'R0865:Apcs'

82277

Institutional Source

Beutler Lab

Gene Symbol

Apcs

Ensembl Gene

ENSMUSG00000026542

Gene Name

amyloid P component, serum

Synonyms

Sap

MMRRC Submission

039039-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R0865 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172721528-172722516 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 172721782 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 188 (D188G)

Ref Sequence

ENSEMBL: ENSMUSP00000027824 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027824]

AlphaFold

P12246

Predicted Effect

probably benign
Transcript: ENSMUST00000027824
AA Change: D188G

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000027824
Gene: ENSMUSG00000026542
AA Change: D188G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PTX	21	224	2.27e-132	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 99.0%
10x: 97.5%
20x: 95.2%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased antibody productions, increased autoimmune antibodies, reduced amyloidosis and glomerulonephrosis depending on strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck5	A	G	15: 76,479,843 (GRCm39)	E581G	probably damaging	Het
Adcy5	A	G	16: 35,094,841 (GRCm39)	N666S	probably damaging	Het
Arih2	A	G	9: 108,526,499 (GRCm39)		probably benign	Het
AU040320	A	G	4: 126,742,677 (GRCm39)	K981E	possibly damaging	Het
Brwd1	A	T	16: 95,869,784 (GRCm39)	I81K	probably damaging	Het
Cacng8	T	A	7: 3,460,625 (GRCm39)	I136N	possibly damaging	Het
Cdh22	A	T	2: 165,022,976 (GRCm39)	W32R	probably damaging	Het
Cel	A	G	2: 28,450,627 (GRCm39)	S133P	probably damaging	Het
Clasp2	A	G	9: 113,740,568 (GRCm39)	T495A	possibly damaging	Het
Clock	A	T	5: 76,414,271 (GRCm39)		probably benign	Het
Cox6a2	A	G	7: 127,804,995 (GRCm39)		probably benign	Het
Cyp2b19	C	A	7: 26,461,654 (GRCm39)		probably benign	Het
Dnah11	G	A	12: 118,154,579 (GRCm39)	Q234*	probably null	Het
Gga3	A	T	11: 115,483,285 (GRCm39)	N91K	probably damaging	Het
Idh1	T	C	1: 65,200,315 (GRCm39)	T350A	probably benign	Het
Ints11	A	G	4: 155,971,564 (GRCm39)		probably null	Het
Itgb1	A	G	8: 129,436,732 (GRCm39)		probably null	Het
Kank4	A	T	4: 98,662,900 (GRCm39)		probably benign	Het
Kansl1	A	T	11: 104,315,194 (GRCm39)	D281E	probably benign	Het
Kmt2a	T	C	9: 44,730,067 (GRCm39)		probably benign	Het
Kpna4	T	C	3: 69,008,750 (GRCm39)	E145G	probably damaging	Het
Lacc1	A	G	14: 77,271,584 (GRCm39)	I201T	possibly damaging	Het
Larp7	T	C	3: 127,337,884 (GRCm39)	K392E	probably damaging	Het
Lbh	T	A	17: 73,228,224 (GRCm39)	M23K	probably benign	Het
Myo15a	A	T	11: 60,382,514 (GRCm39)	E361V	probably damaging	Het
Ncor2	A	G	5: 125,116,046 (GRCm39)	S470P	probably benign	Het
Ngef	T	A	1: 87,412,323 (GRCm39)	M449L	probably benign	Het
Odad1	A	G	7: 45,591,512 (GRCm39)	T259A	probably benign	Het
Or2w3	T	C	11: 58,556,478 (GRCm39)	I31T	possibly damaging	Het
Or7e178	T	A	9: 20,226,045 (GRCm39)	Y57F	probably damaging	Het
Peak1	A	T	9: 56,165,116 (GRCm39)	D937E	probably benign	Het
Pnpla7	A	G	2: 24,872,135 (GRCm39)	K72E	probably benign	Het
Ptprn	T	G	1: 75,224,782 (GRCm39)		probably null	Het
Scgn	C	T	13: 24,146,102 (GRCm39)		probably null	Het
Sdk2	T	C	11: 113,741,748 (GRCm39)	I824V	probably benign	Het
Slc38a3	A	G	9: 107,532,847 (GRCm39)	S326P	probably damaging	Het
Spen	A	G	4: 141,199,181 (GRCm39)	S3126P	probably benign	Het
Tbcd	T	C	11: 121,493,815 (GRCm39)	C902R	possibly damaging	Het
Tmem63b	T	C	17: 45,972,445 (GRCm39)	I721V	probably benign	Het
Trim30c	A	G	7: 104,039,658 (GRCm39)	S46P	probably damaging	Het
Trim59	T	C	3: 68,944,941 (GRCm39)	D133G	probably damaging	Het
Trpm7	A	T	2: 126,641,159 (GRCm39)		probably null	Het
Ttll10	A	G	4: 156,128,135 (GRCm39)	L391P	probably damaging	Het
Ttn	T	C	2: 76,623,585 (GRCm39)	T15331A	possibly damaging	Het
Vmn1r237	C	T	17: 21,534,976 (GRCm39)	T233I	probably damaging	Het
Vmn2r115	A	T	17: 23,565,382 (GRCm39)	D423V	possibly damaging	Het
Vmn2r25	T	A	6: 123,829,976 (GRCm39)	R58S	probably benign	Het
Vmn2r71	A	T	7: 85,268,516 (GRCm39)	I240F	probably benign	Het
Wdr3	A	G	3: 100,060,112 (GRCm39)		probably benign	Het
Zc3h14	T	C	12: 98,745,528 (GRCm39)		probably null	Het
Zc3hav1	C	T	6: 38,330,837 (GRCm39)		probably benign	Het
Zfp335	A	T	2: 164,741,415 (GRCm39)		probably null	Het

Other mutations in Apcs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01590:Apcs	APN	1	172,722,034 (GRCm39)	missense	probably damaging	0.97
R0040:Apcs	UTSW	1	172,722,023 (GRCm39)	missense	probably benign
R0040:Apcs	UTSW	1	172,722,023 (GRCm39)	missense	probably benign
R1691:Apcs	UTSW	1	172,722,160 (GRCm39)	missense	probably damaging	1.00
R2158:Apcs	UTSW	1	172,722,100 (GRCm39)	missense	probably damaging	1.00
R3411:Apcs	UTSW	1	172,722,130 (GRCm39)	missense	probably damaging	1.00
R3949:Apcs	UTSW	1	172,722,259 (GRCm39)	missense	probably damaging	1.00
R4636:Apcs	UTSW	1	172,721,989 (GRCm39)	missense	probably damaging	1.00
R6911:Apcs	UTSW	1	172,721,752 (GRCm39)	missense	probably benign	0.02
R7218:Apcs	UTSW	1	172,722,231 (GRCm39)	missense	possibly damaging	0.85
R8143:Apcs	UTSW	1	172,721,900 (GRCm39)	missense	probably damaging	1.00
R8287:Apcs	UTSW	1	172,721,814 (GRCm39)	missense	possibly damaging	0.66
R8867:Apcs	UTSW	1	172,722,004 (GRCm39)	missense	possibly damaging	0.94
R9005:Apcs	UTSW	1	172,721,776 (GRCm39)	missense	probably benign	0.41
R9132:Apcs	UTSW	1	172,722,061 (GRCm39)	missense	probably damaging	0.97
R9329:Apcs	UTSW	1	172,722,391 (GRCm39)	missense	probably benign	0.00
RF005:Apcs	UTSW	1	172,721,809 (GRCm39)	missense	probably damaging	1.00
RF024:Apcs	UTSW	1	172,721,809 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGTGAATTCTGCTGCCTTGACC -3'
(R):5'- ACACCTATGTACCACTTGGGAGTCC -3'

Sequencing Primer
(F):5'- TGACCTCTTACACATCGGC -3'
(R):5'- ATTTTGGGTCAATGGAAAGCC -3'

Posted On

2013-11-08