Incidental Mutation 'R0865:Cdh22'
ID82283
Institutional Source Beutler Lab
Gene Symbol Cdh22
Ensembl Gene ENSMUSG00000053166
Gene Namecadherin 22
SynonymsPB-cadherin
MMRRC Submission 039039-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R0865 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165111507-165234853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 165181056 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 32 (W32R)
Ref Sequence ENSEMBL: ENSMUSP00000120785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]
Predicted Effect probably damaging
Transcript: ENSMUST00000065438
AA Change: W32R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: W32R

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138643
AA Change: W32R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166
AA Change: W32R

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,595,643 E581G probably damaging Het
Adcy5 A G 16: 35,274,471 N666S probably damaging Het
Apcs T C 1: 172,894,215 D188G probably benign Het
Arih2 A G 9: 108,649,300 probably benign Het
AU040320 A G 4: 126,848,884 K981E possibly damaging Het
Brwd1 A T 16: 96,068,584 I81K probably damaging Het
Cacng8 T A 7: 3,412,109 I136N possibly damaging Het
Ccdc114 A G 7: 45,942,088 T259A probably benign Het
Cel A G 2: 28,560,615 S133P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Clock A T 5: 76,266,424 probably benign Het
Cox6a2 A G 7: 128,205,823 probably benign Het
Cyp2b19 C A 7: 26,762,229 probably benign Het
Dnah11 G A 12: 118,190,844 Q234* probably null Het
Gga3 A T 11: 115,592,459 N91K probably damaging Het
Idh1 T C 1: 65,161,156 T350A probably benign Het
Ints11 A G 4: 155,887,107 probably null Het
Itgb1 A G 8: 128,710,251 probably null Het
Kank4 A T 4: 98,774,663 probably benign Het
Kansl1 A T 11: 104,424,368 D281E probably benign Het
Kmt2a T C 9: 44,818,770 probably benign Het
Kpna4 T C 3: 69,101,417 E145G probably damaging Het
Lacc1 A G 14: 77,034,144 I201T possibly damaging Het
Larp7 T C 3: 127,544,235 K392E probably damaging Het
Lbh T A 17: 72,921,229 M23K probably benign Het
Myo15 A T 11: 60,491,688 E361V probably damaging Het
Ncor2 A G 5: 125,038,982 S470P probably benign Het
Ngef T A 1: 87,484,601 M449L probably benign Het
Olfr18 T A 9: 20,314,749 Y57F probably damaging Het
Olfr322 T C 11: 58,665,652 I31T possibly damaging Het
Peak1 A T 9: 56,257,832 D937E probably benign Het
Pnpla7 A G 2: 24,982,123 K72E probably benign Het
Ptprn T G 1: 75,248,138 probably null Het
Scgn C T 13: 23,962,119 probably null Het
Sdk2 T C 11: 113,850,922 I824V probably benign Het
Slc38a3 A G 9: 107,655,648 S326P probably damaging Het
Spen A G 4: 141,471,870 S3126P probably benign Het
Tbcd T C 11: 121,602,989 C902R possibly damaging Het
Tmem63b T C 17: 45,661,519 I721V probably benign Het
Trim30c A G 7: 104,390,451 S46P probably damaging Het
Trim59 T C 3: 69,037,608 D133G probably damaging Het
Trpm7 A T 2: 126,799,239 probably null Het
Ttll10 A G 4: 156,043,678 L391P probably damaging Het
Ttn T C 2: 76,793,241 T15331A possibly damaging Het
Vmn1r237 C T 17: 21,314,714 T233I probably damaging Het
Vmn2r115 A T 17: 23,346,408 D423V possibly damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Vmn2r71 A T 7: 85,619,308 I240F probably benign Het
Wdr3 A G 3: 100,152,796 probably benign Het
Zc3h14 T C 12: 98,779,269 probably null Het
Zc3hav1 C T 6: 38,353,902 probably benign Het
Zfp335 A T 2: 164,899,495 probably null Het
Other mutations in Cdh22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cdh22 APN 2 165112601 missense possibly damaging 0.54
IGL01868:Cdh22 APN 2 165157358 missense probably damaging 0.99
IGL01932:Cdh22 APN 2 165170808 missense probably benign 0.05
IGL02268:Cdh22 APN 2 165123719 splice site probably benign
IGL02455:Cdh22 APN 2 165142255 missense possibly damaging 0.46
IGL03231:Cdh22 APN 2 165116206 missense probably benign 0.16
IGL03264:Cdh22 APN 2 165116173 missense probably benign 0.21
IGL03014:Cdh22 UTSW 2 165112411 nonsense probably null
R0712:Cdh22 UTSW 2 165170656 missense probably damaging 1.00
R1192:Cdh22 UTSW 2 165135283 missense probably damaging 1.00
R1700:Cdh22 UTSW 2 165170796 missense probably damaging 1.00
R1844:Cdh22 UTSW 2 165143694 missense probably damaging 1.00
R2005:Cdh22 UTSW 2 165180923 missense probably damaging 1.00
R2137:Cdh22 UTSW 2 165116394 splice site probably benign
R2270:Cdh22 UTSW 2 165143847 splice site probably null
R2271:Cdh22 UTSW 2 165143847 splice site probably null
R2272:Cdh22 UTSW 2 165143847 splice site probably null
R4021:Cdh22 UTSW 2 165143673 missense possibly damaging 0.81
R4022:Cdh22 UTSW 2 165157253 missense probably benign 0.14
R4613:Cdh22 UTSW 2 165143656 missense probably benign
R4625:Cdh22 UTSW 2 165112606 missense probably damaging 1.00
R5038:Cdh22 UTSW 2 165142277 missense probably benign 0.16
R5057:Cdh22 UTSW 2 165116143 missense probably damaging 0.98
R5649:Cdh22 UTSW 2 165116280 missense probably damaging 1.00
R6175:Cdh22 UTSW 2 165146630 missense probably damaging 0.98
R6297:Cdh22 UTSW 2 165143644 missense possibly damaging 0.86
R6445:Cdh22 UTSW 2 165170692 missense probably damaging 0.97
R7294:Cdh22 UTSW 2 165142093 missense possibly damaging 0.94
R7310:Cdh22 UTSW 2 165112294 nonsense probably null
R7595:Cdh22 UTSW 2 165112463 missense probably benign 0.00
R7601:Cdh22 UTSW 2 165112546 missense probably damaging 1.00
R8047:Cdh22 UTSW 2 165170767 missense probably damaging 1.00
R8308:Cdh22 UTSW 2 165112178 missense probably damaging 0.99
Z1088:Cdh22 UTSW 2 165112430 missense probably benign 0.01
Z1176:Cdh22 UTSW 2 165116184 missense probably damaging 1.00
Z1177:Cdh22 UTSW 2 165146680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTACTGCATCGACAGTGGAAAG -3'
(R):5'- ATGGCACAAGCCCTATTCAGGAGC -3'

Sequencing Primer
(F):5'- GAACCGGGACTACCAGTG -3'
(R):5'- AGGCTGCCTGGTGACTG -3'
Posted On2013-11-08