Incidental Mutation 'R0865:Kpna4'
ID82285
Institutional Source Beutler Lab
Gene Symbol Kpna4
Ensembl Gene ENSMUSG00000027782
Gene Namekaryopherin (importin) alpha 4
Synonyms1110058D08Rik, IPOA3
MMRRC Submission 039039-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0865 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location69067149-69127113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69101417 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 145 (E145G)
Ref Sequence ENSEMBL: ENSMUSP00000029353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029353] [ENSMUST00000127497] [ENSMUST00000194558]
Predicted Effect probably damaging
Transcript: ENSMUST00000029353
AA Change: E145G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029353
Gene: ENSMUSG00000027782
AA Change: E145G

DomainStartEndE-ValueType
Pfam:IBB 7 93 2.4e-25 PFAM
ARM 103 144 7.73e-11 SMART
ARM 146 186 3.81e-10 SMART
ARM 188 229 2.04e1 SMART
ARM 232 271 4.15e-2 SMART
ARM 273 313 4.69e-10 SMART
ARM 315 355 9.6e-7 SMART
ARM 357 397 1.85e-8 SMART
ARM 400 440 9.45e-6 SMART
Pfam:Arm_3 447 499 4.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127497
AA Change: E19G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121076
Gene: ENSMUSG00000027782
AA Change: E19G

DomainStartEndE-ValueType
Pfam:IBB 1 70 5.4e-21 PFAM
Pfam:Arm 79 112 5.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194558
AA Change: E43G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141227
Gene: ENSMUSG00000027782
AA Change: E43G

DomainStartEndE-ValueType
Pfam:IBB 3 94 2.2e-27 PFAM
ARM 103 144 7.73e-11 SMART
ARM 146 186 3.81e-10 SMART
ARM 188 229 2.04e1 SMART
ARM 232 271 4.15e-2 SMART
ARM 273 313 4.69e-10 SMART
ARM 315 355 9.6e-7 SMART
ARM 357 397 1.85e-8 SMART
ARM 400 440 9.45e-6 SMART
low complexity region 479 493 N/A INTRINSIC
Meta Mutation Damage Score 0.6773 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear import of karyophilic proteins is directed by short amino acid sequences termed nuclear localization signals (NLSs). Karyopherins, or importins, are cytoplasmic proteins that recognize NLSs and dock NLS-containing proteins to the nuclear pore complex. The protein encoded by this gene shares the sequence similarity with Xenopus importin-alpha and Saccharomyces cerevisiae Srp1. This protein is found to interact with the NLSs of DNA helicase Q1 and SV40 T antigen. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,595,643 E581G probably damaging Het
Adcy5 A G 16: 35,274,471 N666S probably damaging Het
Apcs T C 1: 172,894,215 D188G probably benign Het
Arih2 A G 9: 108,649,300 probably benign Het
AU040320 A G 4: 126,848,884 K981E possibly damaging Het
Brwd1 A T 16: 96,068,584 I81K probably damaging Het
Cacng8 T A 7: 3,412,109 I136N possibly damaging Het
Ccdc114 A G 7: 45,942,088 T259A probably benign Het
Cdh22 A T 2: 165,181,056 W32R probably damaging Het
Cel A G 2: 28,560,615 S133P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Clock A T 5: 76,266,424 probably benign Het
Cox6a2 A G 7: 128,205,823 probably benign Het
Cyp2b19 C A 7: 26,762,229 probably benign Het
Dnah11 G A 12: 118,190,844 Q234* probably null Het
Gga3 A T 11: 115,592,459 N91K probably damaging Het
Idh1 T C 1: 65,161,156 T350A probably benign Het
Ints11 A G 4: 155,887,107 probably null Het
Itgb1 A G 8: 128,710,251 probably null Het
Kank4 A T 4: 98,774,663 probably benign Het
Kansl1 A T 11: 104,424,368 D281E probably benign Het
Kmt2a T C 9: 44,818,770 probably benign Het
Lacc1 A G 14: 77,034,144 I201T possibly damaging Het
Larp7 T C 3: 127,544,235 K392E probably damaging Het
Lbh T A 17: 72,921,229 M23K probably benign Het
Myo15 A T 11: 60,491,688 E361V probably damaging Het
Ncor2 A G 5: 125,038,982 S470P probably benign Het
Ngef T A 1: 87,484,601 M449L probably benign Het
Olfr18 T A 9: 20,314,749 Y57F probably damaging Het
Olfr322 T C 11: 58,665,652 I31T possibly damaging Het
Peak1 A T 9: 56,257,832 D937E probably benign Het
Pnpla7 A G 2: 24,982,123 K72E probably benign Het
Ptprn T G 1: 75,248,138 probably null Het
Scgn C T 13: 23,962,119 probably null Het
Sdk2 T C 11: 113,850,922 I824V probably benign Het
Slc38a3 A G 9: 107,655,648 S326P probably damaging Het
Spen A G 4: 141,471,870 S3126P probably benign Het
Tbcd T C 11: 121,602,989 C902R possibly damaging Het
Tmem63b T C 17: 45,661,519 I721V probably benign Het
Trim30c A G 7: 104,390,451 S46P probably damaging Het
Trim59 T C 3: 69,037,608 D133G probably damaging Het
Trpm7 A T 2: 126,799,239 probably null Het
Ttll10 A G 4: 156,043,678 L391P probably damaging Het
Ttn T C 2: 76,793,241 T15331A possibly damaging Het
Vmn1r237 C T 17: 21,314,714 T233I probably damaging Het
Vmn2r115 A T 17: 23,346,408 D423V possibly damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Vmn2r71 A T 7: 85,619,308 I240F probably benign Het
Wdr3 A G 3: 100,152,796 probably benign Het
Zc3h14 T C 12: 98,779,269 probably null Het
Zc3hav1 C T 6: 38,353,902 probably benign Het
Zfp335 A T 2: 164,899,495 probably null Het
Other mutations in Kpna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Kpna4 APN 3 69102257 splice site probably benign
IGL01642:Kpna4 APN 3 69085784 missense probably damaging 0.99
IGL02752:Kpna4 APN 3 69095530 nonsense probably null
R0702:Kpna4 UTSW 3 69084105 missense probably damaging 1.00
R0919:Kpna4 UTSW 3 69085828 splice site probably benign
R5135:Kpna4 UTSW 3 69092809 critical splice donor site probably null
R5955:Kpna4 UTSW 3 69089801 missense probably benign 0.05
R6008:Kpna4 UTSW 3 69126733 missense probably null 0.81
R7106:Kpna4 UTSW 3 69079464 nonsense probably null
R7153:Kpna4 UTSW 3 69089798 missense probably damaging 1.00
R7155:Kpna4 UTSW 3 69089933 missense probably damaging 1.00
R7294:Kpna4 UTSW 3 69092623 intron probably null
R7456:Kpna4 UTSW 3 69092848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTTGAACTGCACTTAATTGAATTCC -3'
(R):5'- TGCTTCCAAATGATGTGTAAAGTGACTTAGAT -3'

Sequencing Primer
(F):5'- GAATTCCTTGGTTATCACTTGAAGC -3'
(R):5'- CATTGGAAATGAATGTTTGGGATTG -3'
Posted On2013-11-08