Mutagenetix > Incidental Mutation

Incidental Mutation 'R0865:Clock'

82294

Institutional Source

Beutler Lab

Gene Symbol

Clock

Ensembl Gene

ENSMUSG00000029238

Gene Name

circadian locomotor output cycles kaput

Synonyms

5330400M04Rik, bHLHe8, KAT13D

MMRRC Submission

039039-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.631) question?

Stock #

R0865 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76209868-76304792 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 76266424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]

AlphaFold

O08785

Predicted Effect

probably benign
Transcript: ENSMUST00000075159

SMART Domains

Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200957

Predicted Effect

probably benign
Transcript: ENSMUST00000202122

SMART Domains

Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238

Domain	Start	End	E-Value	Type
TFS2N	34	106	4.1e-3	SMART
HLH	40	90	3.4e-14	SMART
PAS	109	175	9.6e-9	SMART
PAS	264	330	1.8e-6	SMART
PAC	336	379	3.9e-9	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	633	N/A	INTRINSIC
low complexity region	639	656	N/A	INTRINSIC
low complexity region	737	795	N/A	INTRINSIC
low complexity region	817	836	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202651

SMART Domains

Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202857

Coding Region Coverage

1x: 99.6%
3x: 99.0%
10x: 97.5%
20x: 95.2%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck5	A	G	15: 76,595,643	E581G	probably damaging	Het
Adcy5	A	G	16: 35,274,471	N666S	probably damaging	Het
Apcs	T	C	1: 172,894,215	D188G	probably benign	Het
Arih2	A	G	9: 108,649,300		probably benign	Het
AU040320	A	G	4: 126,848,884	K981E	possibly damaging	Het
Brwd1	A	T	16: 96,068,584	I81K	probably damaging	Het
Cacng8	T	A	7: 3,412,109	I136N	possibly damaging	Het
Ccdc114	A	G	7: 45,942,088	T259A	probably benign	Het
Cdh22	A	T	2: 165,181,056	W32R	probably damaging	Het
Cel	A	G	2: 28,560,615	S133P	probably damaging	Het
Clasp2	A	G	9: 113,911,500	T495A	possibly damaging	Het
Cox6a2	A	G	7: 128,205,823		probably benign	Het
Cyp2b19	C	A	7: 26,762,229		probably benign	Het
Dnah11	G	A	12: 118,190,844	Q234*	probably null	Het
Gga3	A	T	11: 115,592,459	N91K	probably damaging	Het
Idh1	T	C	1: 65,161,156	T350A	probably benign	Het
Ints11	A	G	4: 155,887,107		probably null	Het
Itgb1	A	G	8: 128,710,251		probably null	Het
Kank4	A	T	4: 98,774,663		probably benign	Het
Kansl1	A	T	11: 104,424,368	D281E	probably benign	Het
Kmt2a	T	C	9: 44,818,770		probably benign	Het
Kpna4	T	C	3: 69,101,417	E145G	probably damaging	Het
Lacc1	A	G	14: 77,034,144	I201T	possibly damaging	Het
Larp7	T	C	3: 127,544,235	K392E	probably damaging	Het
Lbh	T	A	17: 72,921,229	M23K	probably benign	Het
Myo15	A	T	11: 60,491,688	E361V	probably damaging	Het
Ncor2	A	G	5: 125,038,982	S470P	probably benign	Het
Ngef	T	A	1: 87,484,601	M449L	probably benign	Het
Olfr18	T	A	9: 20,314,749	Y57F	probably damaging	Het
Olfr322	T	C	11: 58,665,652	I31T	possibly damaging	Het
Peak1	A	T	9: 56,257,832	D937E	probably benign	Het
Pnpla7	A	G	2: 24,982,123	K72E	probably benign	Het
Ptprn	T	G	1: 75,248,138		probably null	Het
Scgn	C	T	13: 23,962,119		probably null	Het
Sdk2	T	C	11: 113,850,922	I824V	probably benign	Het
Slc38a3	A	G	9: 107,655,648	S326P	probably damaging	Het
Spen	A	G	4: 141,471,870	S3126P	probably benign	Het
Tbcd	T	C	11: 121,602,989	C902R	possibly damaging	Het
Tmem63b	T	C	17: 45,661,519	I721V	probably benign	Het
Trim30c	A	G	7: 104,390,451	S46P	probably damaging	Het
Trim59	T	C	3: 69,037,608	D133G	probably damaging	Het
Trpm7	A	T	2: 126,799,239		probably null	Het
Ttll10	A	G	4: 156,043,678	L391P	probably damaging	Het
Ttn	T	C	2: 76,793,241	T15331A	possibly damaging	Het
Vmn1r237	C	T	17: 21,314,714	T233I	probably damaging	Het
Vmn2r115	A	T	17: 23,346,408	D423V	possibly damaging	Het
Vmn2r25	T	A	6: 123,853,017	R58S	probably benign	Het
Vmn2r71	A	T	7: 85,619,308	I240F	probably benign	Het
Wdr3	A	G	3: 100,152,796		probably benign	Het
Zc3h14	T	C	12: 98,779,269		probably null	Het
Zc3hav1	C	T	6: 38,353,902		probably benign	Het
Zfp335	A	T	2: 164,899,495		probably null	Het

Other mutations in Clock

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Clock	APN	5	76229464	missense	probably benign	0.17
IGL00725:Clock	APN	5	76254413	nonsense	probably null
IGL01304:Clock	APN	5	76266355	critical splice donor site	probably null
IGL01369:Clock	APN	5	76237086	missense	probably benign	0.30
IGL01542:Clock	APN	5	76231475	missense	possibly damaging	0.82
IGL02541:Clock	APN	5	76262672	splice site	probably null
IGL02602:Clock	APN	5	76254426	missense	probably null	1.00
IGL02602:Clock	APN	5	76254427	missense	probably damaging	1.00
IGL03186:Clock	APN	5	76243082	missense	probably damaging	0.98
IGL03309:Clock	APN	5	76231394	critical splice donor site	probably null
R6760_Clock_188	UTSW	5	76226976	missense	unknown
uhr	UTSW	5	76229554	nonsense	probably null
R0304:Clock	UTSW	5	76226985	missense	unknown
R0593:Clock	UTSW	5	76265836	missense	probably benign	0.25
R0654:Clock	UTSW	5	76227129	missense	possibly damaging	0.95
R0684:Clock	UTSW	5	76245518	missense	probably damaging	0.96
R0707:Clock	UTSW	5	76227129	missense	possibly damaging	0.95
R0751:Clock	UTSW	5	76229361	missense	possibly damaging	0.75
R0920:Clock	UTSW	5	76230320	missense	possibly damaging	0.80
R1396:Clock	UTSW	5	76266802	missense	probably benign	0.00
R1450:Clock	UTSW	5	76262731	nonsense	probably null
R1487:Clock	UTSW	5	76266354	splice site	probably null
R1574:Clock	UTSW	5	76242832	missense	probably damaging	1.00
R1574:Clock	UTSW	5	76242832	missense	probably damaging	1.00
R1858:Clock	UTSW	5	76240909	missense	possibly damaging	0.92
R1872:Clock	UTSW	5	76248462	missense	possibly damaging	0.67
R1905:Clock	UTSW	5	76266888	splice site	probably benign
R1937:Clock	UTSW	5	76229493	missense	probably damaging	0.99
R2411:Clock	UTSW	5	76231513	missense	probably benign	0.08
R2887:Clock	UTSW	5	76245273	missense	probably damaging	0.99
R3410:Clock	UTSW	5	76229554	nonsense	probably null
R4514:Clock	UTSW	5	76230199	missense	probably benign	0.00
R4598:Clock	UTSW	5	76235810	missense	probably benign	0.00
R4599:Clock	UTSW	5	76235810	missense	probably benign	0.00
R4795:Clock	UTSW	5	76265916	missense	probably damaging	1.00
R4796:Clock	UTSW	5	76265916	missense	probably damaging	1.00
R4973:Clock	UTSW	5	76254411	missense	possibly damaging	0.62
R5204:Clock	UTSW	5	76243170	splice site	probably null
R5271:Clock	UTSW	5	76241954	missense	probably damaging	1.00
R5547:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5630:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5631:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5632:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5787:Clock	UTSW	5	76237051	missense	probably damaging	1.00
R6274:Clock	UTSW	5	76237153	missense	probably benign	0.45
R6578:Clock	UTSW	5	76216709	missense	unknown
R6622:Clock	UTSW	5	76241954	missense	probably damaging	1.00
R6760:Clock	UTSW	5	76226976	missense	unknown
R6793:Clock	UTSW	5	76237120	frame shift	probably null
R7406:Clock	UTSW	5	76266845	start codon destroyed	probably null	0.26
R7414:Clock	UTSW	5	76262764	missense	probably benign	0.00
R7560:Clock	UTSW	5	76242891	splice site	probably null
R7593:Clock	UTSW	5	76236298	missense	possibly damaging	0.80
R7640:Clock	UTSW	5	76248378	missense	possibly damaging	0.71
R7708:Clock	UTSW	5	76266409	missense	probably benign	0.00
R7713:Clock	UTSW	5	76245420	critical splice donor site	probably null
R7807:Clock	UTSW	5	76243135	missense	probably benign	0.01
R8171:Clock	UTSW	5	76266414	missense	possibly damaging	0.94
R8190:Clock	UTSW	5	76227204	missense	probably damaging	0.98
R8225:Clock	UTSW	5	76241912	missense	probably damaging	0.99
R8309:Clock	UTSW	5	76254422	missense	probably benign	0.07
R8557:Clock	UTSW	5	76229370	missense	probably damaging	1.00
R8792:Clock	UTSW	5	76262727	missense	probably damaging	1.00
R8869:Clock	UTSW	5	76227042	small deletion	probably benign
R8870:Clock	UTSW	5	76235785	missense	probably benign	0.17
R8980:Clock	UTSW	5	76254439	missense	probably benign	0.01
R8982:Clock	UTSW	5	76216712	missense	unknown
R9177:Clock	UTSW	5	76229409	missense	probably benign	0.00
R9208:Clock	UTSW	5	76237024	missense	probably benign	0.00
R9213:Clock	UTSW	5	76245529	missense	possibly damaging	0.94
R9307:Clock	UTSW	5	76216824	missense	unknown
R9446:Clock	UTSW	5	76248441	missense	probably benign	0.00
R9516:Clock	UTSW	5	76229380	missense	possibly damaging	0.85
R9572:Clock	UTSW	5	76229491	missense	probably benign	0.00
R9630:Clock	UTSW	5	76245434	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCGCGTTACCAGGAAGCATAGACC -3'
(R):5'- AGCTGAGTATCACTGCCTTCAGAGT -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- GCTTGTTTCCTTGATCACCTGG -3'

Posted On

2013-11-08