Incidental Mutation 'R0865:Cyp2b19'
ID 82299
Institutional Source Beutler Lab
Gene Symbol Cyp2b19
Ensembl Gene ENSMUSG00000066704
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 19
Synonyms
MMRRC Submission 039039-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R0865 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 26456567-26472055 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 26461654 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077855]
AlphaFold O55071
Predicted Effect probably benign
Transcript: ENSMUST00000077855
SMART Domains Protein: ENSMUSP00000077021
Gene: ENSMUSG00000066704

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:p450 32 489 8.7e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138018
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,479,843 (GRCm39) E581G probably damaging Het
Adcy5 A G 16: 35,094,841 (GRCm39) N666S probably damaging Het
Apcs T C 1: 172,721,782 (GRCm39) D188G probably benign Het
Arih2 A G 9: 108,526,499 (GRCm39) probably benign Het
AU040320 A G 4: 126,742,677 (GRCm39) K981E possibly damaging Het
Brwd1 A T 16: 95,869,784 (GRCm39) I81K probably damaging Het
Cacng8 T A 7: 3,460,625 (GRCm39) I136N possibly damaging Het
Cdh22 A T 2: 165,022,976 (GRCm39) W32R probably damaging Het
Cel A G 2: 28,450,627 (GRCm39) S133P probably damaging Het
Clasp2 A G 9: 113,740,568 (GRCm39) T495A possibly damaging Het
Clock A T 5: 76,414,271 (GRCm39) probably benign Het
Cox6a2 A G 7: 127,804,995 (GRCm39) probably benign Het
Dnah11 G A 12: 118,154,579 (GRCm39) Q234* probably null Het
Gga3 A T 11: 115,483,285 (GRCm39) N91K probably damaging Het
Idh1 T C 1: 65,200,315 (GRCm39) T350A probably benign Het
Ints11 A G 4: 155,971,564 (GRCm39) probably null Het
Itgb1 A G 8: 129,436,732 (GRCm39) probably null Het
Kank4 A T 4: 98,662,900 (GRCm39) probably benign Het
Kansl1 A T 11: 104,315,194 (GRCm39) D281E probably benign Het
Kmt2a T C 9: 44,730,067 (GRCm39) probably benign Het
Kpna4 T C 3: 69,008,750 (GRCm39) E145G probably damaging Het
Lacc1 A G 14: 77,271,584 (GRCm39) I201T possibly damaging Het
Larp7 T C 3: 127,337,884 (GRCm39) K392E probably damaging Het
Lbh T A 17: 73,228,224 (GRCm39) M23K probably benign Het
Myo15a A T 11: 60,382,514 (GRCm39) E361V probably damaging Het
Ncor2 A G 5: 125,116,046 (GRCm39) S470P probably benign Het
Ngef T A 1: 87,412,323 (GRCm39) M449L probably benign Het
Odad1 A G 7: 45,591,512 (GRCm39) T259A probably benign Het
Or2w3 T C 11: 58,556,478 (GRCm39) I31T possibly damaging Het
Or7e178 T A 9: 20,226,045 (GRCm39) Y57F probably damaging Het
Peak1 A T 9: 56,165,116 (GRCm39) D937E probably benign Het
Pnpla7 A G 2: 24,872,135 (GRCm39) K72E probably benign Het
Ptprn T G 1: 75,224,782 (GRCm39) probably null Het
Scgn C T 13: 24,146,102 (GRCm39) probably null Het
Sdk2 T C 11: 113,741,748 (GRCm39) I824V probably benign Het
Slc38a3 A G 9: 107,532,847 (GRCm39) S326P probably damaging Het
Spen A G 4: 141,199,181 (GRCm39) S3126P probably benign Het
Tbcd T C 11: 121,493,815 (GRCm39) C902R possibly damaging Het
Tmem63b T C 17: 45,972,445 (GRCm39) I721V probably benign Het
Trim30c A G 7: 104,039,658 (GRCm39) S46P probably damaging Het
Trim59 T C 3: 68,944,941 (GRCm39) D133G probably damaging Het
Trpm7 A T 2: 126,641,159 (GRCm39) probably null Het
Ttll10 A G 4: 156,128,135 (GRCm39) L391P probably damaging Het
Ttn T C 2: 76,623,585 (GRCm39) T15331A possibly damaging Het
Vmn1r237 C T 17: 21,534,976 (GRCm39) T233I probably damaging Het
Vmn2r115 A T 17: 23,565,382 (GRCm39) D423V possibly damaging Het
Vmn2r25 T A 6: 123,829,976 (GRCm39) R58S probably benign Het
Vmn2r71 A T 7: 85,268,516 (GRCm39) I240F probably benign Het
Wdr3 A G 3: 100,060,112 (GRCm39) probably benign Het
Zc3h14 T C 12: 98,745,528 (GRCm39) probably null Het
Zc3hav1 C T 6: 38,330,837 (GRCm39) probably benign Het
Zfp335 A T 2: 164,741,415 (GRCm39) probably null Het
Other mutations in Cyp2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cyp2b19 APN 7 26,462,886 (GRCm39) missense possibly damaging 0.91
IGL01338:Cyp2b19 APN 7 26,458,842 (GRCm39) missense probably benign 0.09
IGL01374:Cyp2b19 APN 7 26,458,504 (GRCm39) missense probably benign 0.06
IGL01613:Cyp2b19 APN 7 26,462,886 (GRCm39) missense possibly damaging 0.91
IGL01695:Cyp2b19 APN 7 26,458,489 (GRCm39) missense probably damaging 1.00
IGL02322:Cyp2b19 APN 7 26,461,803 (GRCm39) missense possibly damaging 0.79
IGL03077:Cyp2b19 APN 7 26,461,809 (GRCm39) missense probably benign
R0047:Cyp2b19 UTSW 7 26,466,251 (GRCm39) missense probably benign 0.01
R0047:Cyp2b19 UTSW 7 26,466,251 (GRCm39) missense probably benign 0.01
R0452:Cyp2b19 UTSW 7 26,466,187 (GRCm39) missense probably benign 0.01
R1514:Cyp2b19 UTSW 7 26,466,585 (GRCm39) missense probably benign 0.00
R1681:Cyp2b19 UTSW 7 26,462,765 (GRCm39) splice site probably null
R2362:Cyp2b19 UTSW 7 26,463,802 (GRCm39) missense probably damaging 1.00
R4015:Cyp2b19 UTSW 7 26,461,768 (GRCm39) missense probably damaging 1.00
R4259:Cyp2b19 UTSW 7 26,462,807 (GRCm39) missense probably damaging 1.00
R4592:Cyp2b19 UTSW 7 26,470,819 (GRCm39) missense probably benign 0.04
R4705:Cyp2b19 UTSW 7 26,456,717 (GRCm39) missense probably benign 0.03
R4789:Cyp2b19 UTSW 7 26,463,801 (GRCm39) missense probably benign 0.16
R5481:Cyp2b19 UTSW 7 26,466,246 (GRCm39) missense probably damaging 0.99
R5749:Cyp2b19 UTSW 7 26,462,844 (GRCm39) missense possibly damaging 0.84
R6041:Cyp2b19 UTSW 7 26,458,852 (GRCm39) missense probably damaging 1.00
R6170:Cyp2b19 UTSW 7 26,458,519 (GRCm39) missense possibly damaging 0.80
R6259:Cyp2b19 UTSW 7 26,470,817 (GRCm39) missense possibly damaging 0.91
R6370:Cyp2b19 UTSW 7 26,462,783 (GRCm39) missense probably benign 0.07
R6519:Cyp2b19 UTSW 7 26,458,536 (GRCm39) missense probably benign
R6656:Cyp2b19 UTSW 7 26,466,280 (GRCm39) missense probably benign
R7283:Cyp2b19 UTSW 7 26,466,339 (GRCm39) missense probably damaging 1.00
R7583:Cyp2b19 UTSW 7 26,458,489 (GRCm39) missense probably damaging 1.00
R7686:Cyp2b19 UTSW 7 26,461,768 (GRCm39) missense probably damaging 1.00
R7732:Cyp2b19 UTSW 7 26,470,769 (GRCm39) missense possibly damaging 0.67
R7831:Cyp2b19 UTSW 7 26,466,565 (GRCm39) missense possibly damaging 0.80
R8035:Cyp2b19 UTSW 7 26,470,675 (GRCm39) missense probably damaging 1.00
R8853:Cyp2b19 UTSW 7 26,456,645 (GRCm39) missense possibly damaging 0.53
R9574:Cyp2b19 UTSW 7 26,466,353 (GRCm39) missense probably null 1.00
R9574:Cyp2b19 UTSW 7 26,466,352 (GRCm39) missense probably damaging 1.00
R9650:Cyp2b19 UTSW 7 26,466,208 (GRCm39) missense possibly damaging 0.85
R9681:Cyp2b19 UTSW 7 26,466,328 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCACTCTGTATGCTACCAACACTG -3'
(R):5'- CGCTCTAACCTGTTAAACATGCCCC -3'

Sequencing Primer
(F):5'- GCATCTTATGTCCGATATCCtgag -3'
(R):5'- TTCACCTACAAAGCAATCTCTTG -3'
Posted On 2013-11-08