Mutagenetix > Incidental Mutation

Incidental Mutation 'R0865:Zc3h14'

82318

Institutional Source

Beutler Lab

Gene Symbol

Zc3h14

Ensembl Gene

ENSMUSG00000021012

Gene Name

zinc finger CCCH type containing 14

Synonyms

1700016A15Rik, 1010001P15Rik, 2700069A02Rik

MMRRC Submission

039039-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0865 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98746964-98787753 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 98779269 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021399] [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532]

AlphaFold

Q8BJ05

Predicted Effect

probably benign
Transcript: ENSMUST00000021399

SMART Domains

Protein: ENSMUSP00000021399
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
coiled coil region	69	91	N/A	INTRINSIC
ZnF_C3H1	170	193	7.16e-1	SMART
ZnF_C3H1	195	214	5.27e1	SMART
ZnF_C3H1	250	272	5.55e0	SMART
Pfam:zf-CCCH_2	273	290	1.3e-3	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000057000

SMART Domains

Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	440	463	7.16e-1	SMART
ZnF_C3H1	465	484	5.27e1	SMART
ZnF_C3H1	520	542	5.55e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110104

SMART Domains

Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	465	488	7.16e-1	SMART
ZnF_C3H1	490	509	5.27e1	SMART
ZnF_C3H1	545	567	5.55e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110105

SMART Domains

Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	596	619	7.16e-1	SMART
ZnF_C3H1	621	640	5.27e1	SMART
ZnF_C3H1	676	698	5.55e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221532

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221576

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222146

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222461

Predicted Effect

probably benign
Transcript: ENSMUST00000223451

Meta Mutation Damage Score

0.9494

Coding Region Coverage

1x: 99.6%
3x: 99.0%
10x: 97.5%
20x: 95.2%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck5	A	G	15: 76,595,643	E581G	probably damaging	Het
Adcy5	A	G	16: 35,274,471	N666S	probably damaging	Het
Apcs	T	C	1: 172,894,215	D188G	probably benign	Het
Arih2	A	G	9: 108,649,300		probably benign	Het
AU040320	A	G	4: 126,848,884	K981E	possibly damaging	Het
Brwd1	A	T	16: 96,068,584	I81K	probably damaging	Het
Cacng8	T	A	7: 3,412,109	I136N	possibly damaging	Het
Ccdc114	A	G	7: 45,942,088	T259A	probably benign	Het
Cdh22	A	T	2: 165,181,056	W32R	probably damaging	Het
Cel	A	G	2: 28,560,615	S133P	probably damaging	Het
Clasp2	A	G	9: 113,911,500	T495A	possibly damaging	Het
Clock	A	T	5: 76,266,424		probably benign	Het
Cox6a2	A	G	7: 128,205,823		probably benign	Het
Cyp2b19	C	A	7: 26,762,229		probably benign	Het
Dnah11	G	A	12: 118,190,844	Q234*	probably null	Het
Gga3	A	T	11: 115,592,459	N91K	probably damaging	Het
Idh1	T	C	1: 65,161,156	T350A	probably benign	Het
Ints11	A	G	4: 155,887,107		probably null	Het
Itgb1	A	G	8: 128,710,251		probably null	Het
Kank4	A	T	4: 98,774,663		probably benign	Het
Kansl1	A	T	11: 104,424,368	D281E	probably benign	Het
Kmt2a	T	C	9: 44,818,770		probably benign	Het
Kpna4	T	C	3: 69,101,417	E145G	probably damaging	Het
Lacc1	A	G	14: 77,034,144	I201T	possibly damaging	Het
Larp7	T	C	3: 127,544,235	K392E	probably damaging	Het
Lbh	T	A	17: 72,921,229	M23K	probably benign	Het
Myo15	A	T	11: 60,491,688	E361V	probably damaging	Het
Ncor2	A	G	5: 125,038,982	S470P	probably benign	Het
Ngef	T	A	1: 87,484,601	M449L	probably benign	Het
Olfr18	T	A	9: 20,314,749	Y57F	probably damaging	Het
Olfr322	T	C	11: 58,665,652	I31T	possibly damaging	Het
Peak1	A	T	9: 56,257,832	D937E	probably benign	Het
Pnpla7	A	G	2: 24,982,123	K72E	probably benign	Het
Ptprn	T	G	1: 75,248,138		probably null	Het
Scgn	C	T	13: 23,962,119		probably null	Het
Sdk2	T	C	11: 113,850,922	I824V	probably benign	Het
Slc38a3	A	G	9: 107,655,648	S326P	probably damaging	Het
Spen	A	G	4: 141,471,870	S3126P	probably benign	Het
Tbcd	T	C	11: 121,602,989	C902R	possibly damaging	Het
Tmem63b	T	C	17: 45,661,519	I721V	probably benign	Het
Trim30c	A	G	7: 104,390,451	S46P	probably damaging	Het
Trim59	T	C	3: 69,037,608	D133G	probably damaging	Het
Trpm7	A	T	2: 126,799,239		probably null	Het
Ttll10	A	G	4: 156,043,678	L391P	probably damaging	Het
Ttn	T	C	2: 76,793,241	T15331A	possibly damaging	Het
Vmn1r237	C	T	17: 21,314,714	T233I	probably damaging	Het
Vmn2r115	A	T	17: 23,346,408	D423V	possibly damaging	Het
Vmn2r25	T	A	6: 123,853,017	R58S	probably benign	Het
Vmn2r71	A	T	7: 85,619,308	I240F	probably benign	Het
Wdr3	A	G	3: 100,152,796		probably benign	Het
Zc3hav1	C	T	6: 38,353,902		probably benign	Het
Zfp335	A	T	2: 164,899,495		probably null	Het

Other mutations in Zc3h14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Zc3h14	APN	12	98747524	critical splice donor site	probably null
IGL00946:Zc3h14	APN	12	98759883	splice site	probably benign
IGL00969:Zc3h14	APN	12	98758843	missense	probably benign	0.00
IGL01626:Zc3h14	APN	12	98779186	missense	possibly damaging	0.72
IGL01891:Zc3h14	APN	12	98758947	unclassified	probably benign
IGL02119:Zc3h14	APN	12	98763895	missense	probably benign	0.00
IGL02484:Zc3h14	APN	12	98774301	missense	probably benign	0.14
IGL02744:Zc3h14	APN	12	98784975	missense	possibly damaging	0.67
IGL02894:Zc3h14	APN	12	98758943	critical splice donor site	probably null
R0408:Zc3h14	UTSW	12	98763823	missense	probably damaging	1.00
R0739:Zc3h14	UTSW	12	98757201	missense	probably damaging	0.99
R0926:Zc3h14	UTSW	12	98758590	missense	possibly damaging	0.94
R1530:Zc3h14	UTSW	12	98785003	missense	probably damaging	1.00
R1735:Zc3h14	UTSW	12	98758580	missense	probably damaging	1.00
R1743:Zc3h14	UTSW	12	98779189	missense	probably benign	0.04
R1848:Zc3h14	UTSW	12	98752832	missense	possibly damaging	0.89
R1851:Zc3h14	UTSW	12	98760354	nonsense	probably null
R1978:Zc3h14	UTSW	12	98763922	missense	probably damaging	0.97
R2011:Zc3h14	UTSW	12	98780268	missense	possibly damaging	0.76
R2198:Zc3h14	UTSW	12	98752809	missense	probably damaging	1.00
R2198:Zc3h14	UTSW	12	98752810	missense	possibly damaging	0.94
R2263:Zc3h14	UTSW	12	98758514	missense	probably benign	0.32
R3762:Zc3h14	UTSW	12	98758643	missense	probably damaging	1.00
R4210:Zc3h14	UTSW	12	98785399	missense	probably damaging	1.00
R4353:Zc3h14	UTSW	12	98763960	missense	possibly damaging	0.70
R4360:Zc3h14	UTSW	12	98780197	missense	probably benign	0.09
R4814:Zc3h14	UTSW	12	98752848	missense	probably damaging	1.00
R4815:Zc3h14	UTSW	12	98752848	missense	probably damaging	1.00
R4817:Zc3h14	UTSW	12	98752848	missense	probably damaging	1.00
R4947:Zc3h14	UTSW	12	98759824	missense	probably benign
R5077:Zc3h14	UTSW	12	98757206	critical splice donor site	probably null
R5431:Zc3h14	UTSW	12	98780065	missense	possibly damaging	0.94
R5783:Zc3h14	UTSW	12	98757175	missense	probably damaging	0.99
R5850:Zc3h14	UTSW	12	98779155	missense	probably damaging	0.97
R6034:Zc3h14	UTSW	12	98771373	missense	probably benign	0.01
R6034:Zc3h14	UTSW	12	98771373	missense	probably benign	0.01
R6291:Zc3h14	UTSW	12	98759828	missense	probably damaging	1.00
R6338:Zc3h14	UTSW	12	98758590	missense	possibly damaging	0.94
R6595:Zc3h14	UTSW	12	98757026	missense	probably damaging	0.98
R6737:Zc3h14	UTSW	12	98785046	missense	probably damaging	1.00
R6932:Zc3h14	UTSW	12	98771077	intron	probably benign
R7074:Zc3h14	UTSW	12	98758600	missense	possibly damaging	0.96
R7204:Zc3h14	UTSW	12	98771356	missense	probably damaging	1.00
R7237:Zc3h14	UTSW	12	98780149	missense	probably benign	0.34
R7267:Zc3h14	UTSW	12	98785729	missense	probably damaging	1.00
R8753:Zc3h14	UTSW	12	98758572	missense	probably benign	0.12
R9169:Zc3h14	UTSW	12	98779246	missense	probably damaging	1.00
R9610:Zc3h14	UTSW	12	98771404	missense	possibly damaging	0.92
RF020:Zc3h14	UTSW	12	98780282	critical splice donor site	probably null
RF024:Zc3h14	UTSW	12	98758861	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACCCTTCTCTGCCTTAGGCAAAG -3'
(R):5'- GGAACCACGCAAGCCTTAGTCC -3'

Sequencing Primer
(F):5'- GGCCAATTTTTTTGGCTCAGATTAC -3'
(R):5'- ACCTTGCAGAAGGATTTCCTG -3'

Posted On

2013-11-08