Incidental Mutation 'R0865:Adcy5'
ID82323
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission 039039-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R0865 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35274471 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 666 (N666S)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect probably damaging
Transcript: ENSMUST00000114913
AA Change: N666S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: N666S

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232470
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,595,643 E581G probably damaging Het
Apcs T C 1: 172,894,215 D188G probably benign Het
Arih2 A G 9: 108,649,300 probably benign Het
AU040320 A G 4: 126,848,884 K981E possibly damaging Het
Brwd1 A T 16: 96,068,584 I81K probably damaging Het
Cacng8 T A 7: 3,412,109 I136N possibly damaging Het
Ccdc114 A G 7: 45,942,088 T259A probably benign Het
Cdh22 A T 2: 165,181,056 W32R probably damaging Het
Cel A G 2: 28,560,615 S133P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Clock A T 5: 76,266,424 probably benign Het
Cox6a2 A G 7: 128,205,823 probably benign Het
Cyp2b19 C A 7: 26,762,229 probably benign Het
Dnah11 G A 12: 118,190,844 Q234* probably null Het
Gga3 A T 11: 115,592,459 N91K probably damaging Het
Idh1 T C 1: 65,161,156 T350A probably benign Het
Ints11 A G 4: 155,887,107 probably null Het
Itgb1 A G 8: 128,710,251 probably null Het
Kank4 A T 4: 98,774,663 probably benign Het
Kansl1 A T 11: 104,424,368 D281E probably benign Het
Kmt2a T C 9: 44,818,770 probably benign Het
Kpna4 T C 3: 69,101,417 E145G probably damaging Het
Lacc1 A G 14: 77,034,144 I201T possibly damaging Het
Larp7 T C 3: 127,544,235 K392E probably damaging Het
Lbh T A 17: 72,921,229 M23K probably benign Het
Myo15 A T 11: 60,491,688 E361V probably damaging Het
Ncor2 A G 5: 125,038,982 S470P probably benign Het
Ngef T A 1: 87,484,601 M449L probably benign Het
Olfr18 T A 9: 20,314,749 Y57F probably damaging Het
Olfr322 T C 11: 58,665,652 I31T possibly damaging Het
Peak1 A T 9: 56,257,832 D937E probably benign Het
Pnpla7 A G 2: 24,982,123 K72E probably benign Het
Ptprn T G 1: 75,248,138 probably null Het
Scgn C T 13: 23,962,119 probably null Het
Sdk2 T C 11: 113,850,922 I824V probably benign Het
Slc38a3 A G 9: 107,655,648 S326P probably damaging Het
Spen A G 4: 141,471,870 S3126P probably benign Het
Tbcd T C 11: 121,602,989 C902R possibly damaging Het
Tmem63b T C 17: 45,661,519 I721V probably benign Het
Trim30c A G 7: 104,390,451 S46P probably damaging Het
Trim59 T C 3: 69,037,608 D133G probably damaging Het
Trpm7 A T 2: 126,799,239 probably null Het
Ttll10 A G 4: 156,043,678 L391P probably damaging Het
Ttn T C 2: 76,793,241 T15331A possibly damaging Het
Vmn1r237 C T 17: 21,314,714 T233I probably damaging Het
Vmn2r115 A T 17: 23,346,408 D423V possibly damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Vmn2r71 A T 7: 85,619,308 I240F probably benign Het
Wdr3 A G 3: 100,152,796 probably benign Het
Zc3h14 T C 12: 98,779,269 probably null Het
Zc3hav1 C T 6: 38,353,902 probably benign Het
Zfp335 A T 2: 164,899,495 probably null Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTGTCTGTGCCAAGCATCCC -3'
(R):5'- TGCTGAGTCTGAGCAGCCAAAC -3'

Sequencing Primer
(F):5'- GCCAAGCATCCCAGACTTTG -3'
(R):5'- TATTCCAGCCTAAAGTCAGGGTG -3'
Posted On2013-11-08