Incidental Mutation 'R0866:Kiz'
ID82335
Institutional Source Beutler Lab
Gene Symbol Kiz
Ensembl Gene ENSMUSG00000074749
Gene Namekizuna centrosomal protein
SynonymsPlk1s1, LOC228730, Ncrna00153, Gm114
MMRRC Submission 039040-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0866 (G1)
Quality Score198
Status Validated
Chromosome2
Chromosomal Location146855864-146970097 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 146856053 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099278] [ENSMUST00000156232]
Predicted Effect probably benign
Transcript: ENSMUST00000099278
SMART Domains Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
coiled coil region 102 132 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 376 399 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156232
SMART Domains Protein: ENSMUSP00000121952
Gene: ENSMUSG00000074749

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik G T 6: 131,552,779 R112L unknown Het
Abcd4 G T 12: 84,611,733 A232E probably damaging Het
Acsm5 T A 7: 119,540,900 I508N probably damaging Het
Adam22 T C 5: 8,082,156 Q263R probably damaging Het
Ccdc88c A G 12: 100,913,192 L1890P probably benign Het
Ckap4 C T 10: 84,527,520 D560N probably damaging Het
Crb3 T A 17: 57,062,743 L17Q probably damaging Het
Fbxo21 G T 5: 117,977,033 R78L probably benign Het
Gapvd1 A T 2: 34,709,217 C669S probably damaging Het
Gria2 A T 3: 80,722,024 probably benign Het
H2-M11 T C 17: 36,548,937 L274P probably benign Het
Hmox1 A G 8: 75,097,303 T200A probably benign Het
Hspa8 G A 9: 40,802,624 probably null Het
Isy1 C A 6: 87,819,112 R281L probably benign Het
Lrig2 T C 3: 104,464,275 K704R probably benign Het
Lrp1 A T 10: 127,539,278 D4484E probably damaging Het
Lrrc7 C A 3: 158,164,266 probably benign Het
Mtmr14 T C 6: 113,239,582 probably null Het
Mtmr3 A T 11: 4,488,474 V660E probably benign Het
Mtor T C 4: 148,486,056 I1190T probably benign Het
Mtrf1l T C 10: 5,813,376 R318G probably damaging Het
Myh7 T C 14: 54,973,139 T1739A probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr186 C T 16: 59,027,428 V160I probably benign Het
Pcca A G 14: 122,889,545 E722G possibly damaging Het
Pds5b T A 5: 150,739,191 probably benign Het
Ralgapa2 A T 2: 146,436,003 F413I probably damaging Het
Rbbp9 T C 2: 144,550,708 Y24C probably damaging Het
Rgs2 A G 1: 144,002,250 S103P probably damaging Het
Rtn1 G T 12: 72,308,382 Y263* probably null Het
Slc22a1 T C 17: 12,657,046 E427G probably benign Het
Speg A G 1: 75,417,083 T1695A probably damaging Het
Tlx3 C A 11: 33,203,315 G49W probably damaging Het
Tor1b A G 2: 30,956,916 M292V probably benign Het
Tspyl3 A T 2: 153,224,934 L128Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfc3h1 G A 10: 115,427,716 V1821I probably benign Het
Zfhx4 A T 3: 5,412,212 T3271S possibly damaging Het
Zfp386 G T 12: 116,054,709 probably benign Het
Zfp574 A T 7: 25,079,898 K115M probably damaging Het
Other mutations in Kiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Kiz APN 2 146863801 missense probably benign 0.22
IGL01649:Kiz APN 2 146889309 missense probably benign 0.35
IGL02184:Kiz APN 2 146889600 missense probably benign 0.20
IGL02500:Kiz APN 2 146863813 missense probably benign 0.06
IGL02548:Kiz APN 2 146870770 missense probably damaging 0.99
R0284:Kiz UTSW 2 146863810 missense probably benign 0.22
R0364:Kiz UTSW 2 146942156 missense probably benign 0.20
R0478:Kiz UTSW 2 146942158 missense possibly damaging 0.93
R0685:Kiz UTSW 2 146856058 splice site probably benign
R0767:Kiz UTSW 2 146889051 missense probably damaging 1.00
R1180:Kiz UTSW 2 146970007 missense unknown
R2037:Kiz UTSW 2 146969960 missense probably damaging 1.00
R2055:Kiz UTSW 2 146891283 missense probably benign 0.10
R2877:Kiz UTSW 2 146889556 missense possibly damaging 0.75
R4780:Kiz UTSW 2 146889246 missense possibly damaging 0.90
R4822:Kiz UTSW 2 146891069 missense probably damaging 1.00
R4835:Kiz UTSW 2 146942088 missense probably damaging 1.00
R5004:Kiz UTSW 2 146969979 missense possibly damaging 0.83
R5473:Kiz UTSW 2 146969995 nonsense probably null
R5878:Kiz UTSW 2 146889601 missense probably damaging 0.99
R6216:Kiz UTSW 2 146889497 missense probably damaging 1.00
R6222:Kiz UTSW 2 146891061 missense probably damaging 1.00
R7144:Kiz UTSW 2 146950510 splice site probably null
R7475:Kiz UTSW 2 146891086 missense possibly damaging 0.90
R7580:Kiz UTSW 2 146956249 missense probably damaging 0.99
R7848:Kiz UTSW 2 146889180 missense probably benign 0.19
R8395:Kiz UTSW 2 146953029 missense possibly damaging 0.79
R8513:Kiz UTSW 2 146870764 critical splice acceptor site probably null
RF021:Kiz UTSW 2 146870830 missense possibly damaging 0.74
Z1177:Kiz UTSW 2 146935827 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TCACAGGGTCTCTCACTGCAAATTC -3'
(R):5'- GCTTTCAAACAAGGGGCATCCG -3'

Sequencing Primer
(F):5'- ACGTGACACAGCTCCCTTG -3'
(R):5'- CGTGGTAAAGTTGTGCTCCTAAC -3'
Posted On2013-11-08