Incidental Mutation 'R0866:Isy1'
ID82345
Institutional Source Beutler Lab
Gene Symbol Isy1
Ensembl Gene ENSMUSG00000030056
Gene NameISY1 splicing factor homolog
Synonyms5830446M03Rik
MMRRC Submission 039040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R0866 (G1)
Quality Score215
Status Validated
Chromosome6
Chromosomal Location87814269-87838798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87819112 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 281 (R281L)
Ref Sequence ENSEMBL: ENSMUSP00000086923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089497] [ENSMUST00000204419] [ENSMUST00000204881] [ENSMUST00000205070]
PDB Structure
Solution structure of Isy1 domain in hypothetical protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000089497
AA Change: R281L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000086923
Gene: ENSMUSG00000030056
AA Change: R281L

DomainStartEndE-ValueType
Pfam:Isy1 1 266 5.1e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203429
Predicted Effect probably benign
Transcript: ENSMUST00000204169
Predicted Effect probably benign
Transcript: ENSMUST00000204419
SMART Domains Protein: ENSMUSP00000144743
Gene: ENSMUSG00000107928

DomainStartEndE-ValueType
Pfam:Isy1 1 218 1.8e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204881
SMART Domains Protein: ENSMUSP00000144710
Gene: ENSMUSG00000030056

DomainStartEndE-ValueType
Pfam:Isy1 1 124 6.8e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205070
SMART Domains Protein: ENSMUSP00000144956
Gene: ENSMUSG00000030056

DomainStartEndE-ValueType
Pfam:Isy1 1 50 8.1e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents naturally occurring read-through transcription between the neighboring ISY1 (ISY1 splicing factor homolog) and RAB43 (RAB43, member RAS oncogene family) gene on chromosome 3. The read-through transcript encodes a protein that shares sequence identity with the upstream gene product, but its C-terminus is distinct due to a frameshift relative to the downstream gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik G T 6: 131,552,779 R112L unknown Het
Abcd4 G T 12: 84,611,733 A232E probably damaging Het
Acsm5 T A 7: 119,540,900 I508N probably damaging Het
Adam22 T C 5: 8,082,156 Q263R probably damaging Het
Ccdc88c A G 12: 100,913,192 L1890P probably benign Het
Ckap4 C T 10: 84,527,520 D560N probably damaging Het
Crb3 T A 17: 57,062,743 L17Q probably damaging Het
Fbxo21 G T 5: 117,977,033 R78L probably benign Het
Gapvd1 A T 2: 34,709,217 C669S probably damaging Het
Gria2 A T 3: 80,722,024 probably benign Het
H2-M11 T C 17: 36,548,937 L274P probably benign Het
Hmox1 A G 8: 75,097,303 T200A probably benign Het
Hspa8 G A 9: 40,802,624 probably null Het
Kiz C A 2: 146,856,053 probably benign Het
Lrig2 T C 3: 104,464,275 K704R probably benign Het
Lrp1 A T 10: 127,539,278 D4484E probably damaging Het
Lrrc7 C A 3: 158,164,266 probably benign Het
Mtmr14 T C 6: 113,239,582 probably null Het
Mtmr3 A T 11: 4,488,474 V660E probably benign Het
Mtor T C 4: 148,486,056 I1190T probably benign Het
Mtrf1l T C 10: 5,813,376 R318G probably damaging Het
Myh7 T C 14: 54,973,139 T1739A probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr186 C T 16: 59,027,428 V160I probably benign Het
Pcca A G 14: 122,889,545 E722G possibly damaging Het
Pds5b T A 5: 150,739,191 probably benign Het
Ralgapa2 A T 2: 146,436,003 F413I probably damaging Het
Rbbp9 T C 2: 144,550,708 Y24C probably damaging Het
Rgs2 A G 1: 144,002,250 S103P probably damaging Het
Rtn1 G T 12: 72,308,382 Y263* probably null Het
Slc22a1 T C 17: 12,657,046 E427G probably benign Het
Speg A G 1: 75,417,083 T1695A probably damaging Het
Tlx3 C A 11: 33,203,315 G49W probably damaging Het
Tor1b A G 2: 30,956,916 M292V probably benign Het
Tspyl3 A T 2: 153,224,934 L128Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfc3h1 G A 10: 115,427,716 V1821I probably benign Het
Zfhx4 A T 3: 5,412,212 T3271S possibly damaging Het
Zfp386 G T 12: 116,054,709 probably benign Het
Zfp574 A T 7: 25,079,898 K115M probably damaging Het
Other mutations in Isy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4354001:Isy1 UTSW 6 87833671 missense possibly damaging 0.68
R0105:Isy1 UTSW 6 87819185 missense probably damaging 1.00
R0105:Isy1 UTSW 6 87819185 missense probably damaging 1.00
R0106:Isy1 UTSW 6 87819185 missense probably damaging 1.00
R0106:Isy1 UTSW 6 87819185 missense probably damaging 1.00
R0363:Isy1 UTSW 6 87819185 missense probably damaging 1.00
R0718:Isy1 UTSW 6 87819176 missense probably damaging 1.00
R0926:Isy1 UTSW 6 87819143 missense probably benign
R1674:Isy1 UTSW 6 87834487 missense probably damaging 1.00
R3783:Isy1 UTSW 6 87821545 missense possibly damaging 0.70
R7320:Isy1 UTSW 6 87833706 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCACACGGTAGCAAAGGCATC -3'
(R):5'- AAGTGGCTGGGTTCTTGCAGAC -3'

Sequencing Primer
(F):5'- GCGATGGCTACTAAAGCATTC -3'
(R):5'- AGACGTGCTGACCTTGTCC -3'
Posted On2013-11-08