Incidental Mutation 'R0866:Acsm5'
ID 82349
Institutional Source Beutler Lab
Gene Symbol Acsm5
Ensembl Gene ENSMUSG00000030972
Gene Name acyl-CoA synthetase medium-chain family member 5
Synonyms C730027J19Rik
MMRRC Submission 039040-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R0866 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 119519463-119545551 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119540900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 508 (I508N)
Ref Sequence ENSEMBL: ENSMUSP00000146520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066465] [ENSMUST00000207307] [ENSMUST00000207381] [ENSMUST00000207440] [ENSMUST00000207796]
AlphaFold Q8BGA8
Predicted Effect possibly damaging
Transcript: ENSMUST00000066465
AA Change: I508N

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063416
Gene: ENSMUSG00000030972
AA Change: I508N

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
Pfam:AMP-binding 65 477 2.9e-78 PFAM
Pfam:AMP-binding_C 485 565 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207307
Predicted Effect probably benign
Transcript: ENSMUST00000207381
Predicted Effect possibly damaging
Transcript: ENSMUST00000207440
AA Change: I508N

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000207796
AA Change: I508N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.2496 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik G T 6: 131,552,779 R112L unknown Het
Abcd4 G T 12: 84,611,733 A232E probably damaging Het
Adam22 T C 5: 8,082,156 Q263R probably damaging Het
Ccdc88c A G 12: 100,913,192 L1890P probably benign Het
Ckap4 C T 10: 84,527,520 D560N probably damaging Het
Crb3 T A 17: 57,062,743 L17Q probably damaging Het
Fbxo21 G T 5: 117,977,033 R78L probably benign Het
Gapvd1 A T 2: 34,709,217 C669S probably damaging Het
Gria2 A T 3: 80,722,024 probably benign Het
H2-M11 T C 17: 36,548,937 L274P probably benign Het
Hmox1 A G 8: 75,097,303 T200A probably benign Het
Hspa8 G A 9: 40,802,624 probably null Het
Isy1 C A 6: 87,819,112 R281L probably benign Het
Kiz C A 2: 146,856,053 probably benign Het
Lrig2 T C 3: 104,464,275 K704R probably benign Het
Lrp1 A T 10: 127,539,278 D4484E probably damaging Het
Lrrc7 C A 3: 158,164,266 probably benign Het
Mtmr14 T C 6: 113,239,582 probably null Het
Mtmr3 A T 11: 4,488,474 V660E probably benign Het
Mtor T C 4: 148,486,056 I1190T probably benign Het
Mtrf1l T C 10: 5,813,376 R318G probably damaging Het
Myh7 T C 14: 54,973,139 T1739A probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr186 C T 16: 59,027,428 V160I probably benign Het
Pcca A G 14: 122,889,545 E722G possibly damaging Het
Pds5b T A 5: 150,739,191 probably benign Het
Ralgapa2 A T 2: 146,436,003 F413I probably damaging Het
Rbbp9 T C 2: 144,550,708 Y24C probably damaging Het
Rgs2 A G 1: 144,002,250 S103P probably damaging Het
Rtn1 G T 12: 72,308,382 Y263* probably null Het
Slc22a1 T C 17: 12,657,046 E427G probably benign Het
Speg A G 1: 75,417,083 T1695A probably damaging Het
Tlx3 C A 11: 33,203,315 G49W probably damaging Het
Tor1b A G 2: 30,956,916 M292V probably benign Het
Tspyl3 A T 2: 153,224,934 L128Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfc3h1 G A 10: 115,427,716 V1821I probably benign Het
Zfhx4 A T 3: 5,412,212 T3271S possibly damaging Het
Zfp386 G T 12: 116,054,709 probably benign Het
Zfp574 A T 7: 25,079,898 K115M probably damaging Het
Other mutations in Acsm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Acsm5 APN 7 119542438 critical splice donor site probably null
IGL01662:Acsm5 APN 7 119538288 missense probably damaging 1.00
IGL02228:Acsm5 APN 7 119531866 missense probably damaging 1.00
IGL02380:Acsm5 APN 7 119537286 missense probably benign 0.05
IGL02709:Acsm5 APN 7 119534818 nonsense probably null
P4717OSA:Acsm5 UTSW 7 119531972 missense probably benign 0.12
R0506:Acsm5 UTSW 7 119538096 nonsense probably null
R0518:Acsm5 UTSW 7 119535800 missense possibly damaging 0.95
R1171:Acsm5 UTSW 7 119540852 missense probably damaging 0.99
R2362:Acsm5 UTSW 7 119528426 start gained probably benign
R2511:Acsm5 UTSW 7 119530454 missense possibly damaging 0.80
R4670:Acsm5 UTSW 7 119531760 splice site probably null
R4908:Acsm5 UTSW 7 119538091 missense probably damaging 1.00
R4913:Acsm5 UTSW 7 119534343 missense probably damaging 0.98
R5038:Acsm5 UTSW 7 119534811 missense probably damaging 1.00
R5112:Acsm5 UTSW 7 119537279 missense possibly damaging 0.95
R6337:Acsm5 UTSW 7 119534235 missense probably benign 0.00
R6481:Acsm5 UTSW 7 119534881 missense probably benign 0.02
R7268:Acsm5 UTSW 7 119537288 missense probably benign 0.38
R7275:Acsm5 UTSW 7 119537288 missense possibly damaging 0.81
R7509:Acsm5 UTSW 7 119534388 missense probably benign
R7794:Acsm5 UTSW 7 119538129 unclassified probably benign
R8021:Acsm5 UTSW 7 119542393 missense possibly damaging 0.72
R8178:Acsm5 UTSW 7 119542395 missense probably damaging 1.00
R8797:Acsm5 UTSW 7 119538151 missense probably damaging 1.00
Z1088:Acsm5 UTSW 7 119537211 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCACATATGGACGAGGATGGCTAC -3'
(R):5'- AAGGCCACTTGGTTGCAGGTCTAC -3'

Sequencing Primer
(F):5'- ATCAACTCTTCAAGGTCAGGGTAG -3'
(R):5'- tgagcacctattatgtaccagtc -3'
Posted On 2013-11-08