Incidental Mutation 'R0866:Hspa8'
ID82351
Institutional Source Beutler Lab
Gene Symbol Hspa8
Ensembl Gene ENSMUSG00000015656
Gene Nameheat shock protein 8
SynonymsHsp73, Hsc71, Hsc70, 2410008N15Rik, Hsc73
MMRRC Submission 039040-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R0866 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40800984-40810087 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 40802624 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015800] [ENSMUST00000117557] [ENSMUST00000133964]
Predicted Effect probably null
Transcript: ENSMUST00000015800
SMART Domains Protein: ENSMUSP00000015800
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 612 2.3e-272 PFAM
Pfam:MreB_Mbl 117 383 5.3e-19 PFAM
low complexity region 613 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101927
Predicted Effect probably null
Transcript: ENSMUST00000117557
SMART Domains Protein: ENSMUSP00000113722
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 593 3e-255 PFAM
low complexity region 594 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117870
SMART Domains Protein: ENSMUSP00000114081
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 118 2.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127699
Predicted Effect probably benign
Transcript: ENSMUST00000133964
SMART Domains Protein: ENSMUSP00000117285
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 116 2.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215526
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 family, which contains both heat-inducible and constitutively expressed members. This protein belongs to the latter group, which are also referred to as heat-shock cognate proteins. It functions as a chaperone, and binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik G T 6: 131,552,779 R112L unknown Het
Abcd4 G T 12: 84,611,733 A232E probably damaging Het
Acsm5 T A 7: 119,540,900 I508N probably damaging Het
Adam22 T C 5: 8,082,156 Q263R probably damaging Het
Ccdc88c A G 12: 100,913,192 L1890P probably benign Het
Ckap4 C T 10: 84,527,520 D560N probably damaging Het
Crb3 T A 17: 57,062,743 L17Q probably damaging Het
Fbxo21 G T 5: 117,977,033 R78L probably benign Het
Gapvd1 A T 2: 34,709,217 C669S probably damaging Het
Gria2 A T 3: 80,722,024 probably benign Het
H2-M11 T C 17: 36,548,937 L274P probably benign Het
Hmox1 A G 8: 75,097,303 T200A probably benign Het
Isy1 C A 6: 87,819,112 R281L probably benign Het
Kiz C A 2: 146,856,053 probably benign Het
Lrig2 T C 3: 104,464,275 K704R probably benign Het
Lrp1 A T 10: 127,539,278 D4484E probably damaging Het
Lrrc7 C A 3: 158,164,266 probably benign Het
Mtmr14 T C 6: 113,239,582 probably null Het
Mtmr3 A T 11: 4,488,474 V660E probably benign Het
Mtor T C 4: 148,486,056 I1190T probably benign Het
Mtrf1l T C 10: 5,813,376 R318G probably damaging Het
Myh7 T C 14: 54,973,139 T1739A probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr186 C T 16: 59,027,428 V160I probably benign Het
Pcca A G 14: 122,889,545 E722G possibly damaging Het
Pds5b T A 5: 150,739,191 probably benign Het
Ralgapa2 A T 2: 146,436,003 F413I probably damaging Het
Rbbp9 T C 2: 144,550,708 Y24C probably damaging Het
Rgs2 A G 1: 144,002,250 S103P probably damaging Het
Rtn1 G T 12: 72,308,382 Y263* probably null Het
Slc22a1 T C 17: 12,657,046 E427G probably benign Het
Speg A G 1: 75,417,083 T1695A probably damaging Het
Tlx3 C A 11: 33,203,315 G49W probably damaging Het
Tor1b A G 2: 30,956,916 M292V probably benign Het
Tspyl3 A T 2: 153,224,934 L128Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfc3h1 G A 10: 115,427,716 V1821I probably benign Het
Zfhx4 A T 3: 5,412,212 T3271S possibly damaging Het
Zfp386 G T 12: 116,054,709 probably benign Het
Zfp574 A T 7: 25,079,898 K115M probably damaging Het
Other mutations in Hspa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03388:Hspa8 APN 9 40804928 unclassified probably benign
R0006:Hspa8 UTSW 9 40804629 missense probably benign 0.05
R0799:Hspa8 UTSW 9 40803841 missense probably damaging 1.00
R3621:Hspa8 UTSW 9 40801923 start codon destroyed probably damaging 0.96
R4475:Hspa8 UTSW 9 40804146 unclassified probably benign
R5096:Hspa8 UTSW 9 40802901 unclassified probably benign
R6116:Hspa8 UTSW 9 40804975 missense probably damaging 0.98
R6363:Hspa8 UTSW 9 40803065 missense probably damaging 1.00
R7067:Hspa8 UTSW 9 40804625 missense probably damaging 0.97
R7310:Hspa8 UTSW 9 40803408 missense probably benign 0.09
R7549:Hspa8 UTSW 9 40802959 splice site probably null
R7998:Hspa8 UTSW 9 40804514 missense probably damaging 1.00
Z1177:Hspa8 UTSW 9 40802802 missense probably damaging 0.98
Z1177:Hspa8 UTSW 9 40802805 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTCCTGCACTAGAGATTACGTCC -3'
(R):5'- TGCCTGTCGCTGAGAGTCATTG -3'

Sequencing Primer
(F):5'- CAGGtttttgttttctgtttttttgg -3'
(R):5'- TGGTTGGCAAATTCCCGATC -3'
Posted On2013-11-08