Incidental Mutation 'R0866:Mtrf1l'
ID82352
Institutional Source Beutler Lab
Gene Symbol Mtrf1l
Ensembl Gene ENSMUSG00000019774
Gene Namemitochondrial translational release factor 1-like
Synonyms9130004K12Rik
MMRRC Submission 039040-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0866 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location5811887-5823910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5813376 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 318 (R318G)
Ref Sequence ENSEMBL: ENSMUSP00000019908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019908]
Predicted Effect probably damaging
Transcript: ENSMUST00000019908
AA Change: R318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019908
Gene: ENSMUSG00000019774
AA Change: R318G

DomainStartEndE-ValueType
PCRF 75 189 2.26e-36 SMART
Pfam:RF-1 221 331 1.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145718
Meta Mutation Damage Score 0.9272 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. This protein acts upon UAA and UAG stop codons, but has no in vitro activity against UGA, which encodes tryptophan in human mitochondrion, or, the mitochondrial non-cognate stop codons, AGA and AGG. This protein shares sequence similarity to bacterial release factors. Pseudogenes of this gene are found on chromosomes 4, 8, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik G T 6: 131,552,779 R112L unknown Het
Abcd4 G T 12: 84,611,733 A232E probably damaging Het
Acsm5 T A 7: 119,540,900 I508N probably damaging Het
Adam22 T C 5: 8,082,156 Q263R probably damaging Het
Ccdc88c A G 12: 100,913,192 L1890P probably benign Het
Ckap4 C T 10: 84,527,520 D560N probably damaging Het
Crb3 T A 17: 57,062,743 L17Q probably damaging Het
Fbxo21 G T 5: 117,977,033 R78L probably benign Het
Gapvd1 A T 2: 34,709,217 C669S probably damaging Het
Gria2 A T 3: 80,722,024 probably benign Het
H2-M11 T C 17: 36,548,937 L274P probably benign Het
Hmox1 A G 8: 75,097,303 T200A probably benign Het
Hspa8 G A 9: 40,802,624 probably null Het
Isy1 C A 6: 87,819,112 R281L probably benign Het
Kiz C A 2: 146,856,053 probably benign Het
Lrig2 T C 3: 104,464,275 K704R probably benign Het
Lrp1 A T 10: 127,539,278 D4484E probably damaging Het
Lrrc7 C A 3: 158,164,266 probably benign Het
Mtmr14 T C 6: 113,239,582 probably null Het
Mtmr3 A T 11: 4,488,474 V660E probably benign Het
Mtor T C 4: 148,486,056 I1190T probably benign Het
Myh7 T C 14: 54,973,139 T1739A probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr186 C T 16: 59,027,428 V160I probably benign Het
Pcca A G 14: 122,889,545 E722G possibly damaging Het
Pds5b T A 5: 150,739,191 probably benign Het
Ralgapa2 A T 2: 146,436,003 F413I probably damaging Het
Rbbp9 T C 2: 144,550,708 Y24C probably damaging Het
Rgs2 A G 1: 144,002,250 S103P probably damaging Het
Rtn1 G T 12: 72,308,382 Y263* probably null Het
Slc22a1 T C 17: 12,657,046 E427G probably benign Het
Speg A G 1: 75,417,083 T1695A probably damaging Het
Tlx3 C A 11: 33,203,315 G49W probably damaging Het
Tor1b A G 2: 30,956,916 M292V probably benign Het
Tspyl3 A T 2: 153,224,934 L128Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfc3h1 G A 10: 115,427,716 V1821I probably benign Het
Zfhx4 A T 3: 5,412,212 T3271S possibly damaging Het
Zfp386 G T 12: 116,054,709 probably benign Het
Zfp574 A T 7: 25,079,898 K115M probably damaging Het
Other mutations in Mtrf1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Mtrf1l APN 10 5814180 splice site probably benign
IGL01292:Mtrf1l APN 10 5814090 missense probably benign 0.00
IGL01844:Mtrf1l APN 10 5814112 missense probably null 0.76
R0050:Mtrf1l UTSW 10 5815553 splice site silent
R0051:Mtrf1l UTSW 10 5813382 missense probably damaging 1.00
R0051:Mtrf1l UTSW 10 5813384 missense probably damaging 1.00
R1636:Mtrf1l UTSW 10 5813265 missense probably damaging 0.98
R2897:Mtrf1l UTSW 10 5817565 missense probably benign 0.16
R4020:Mtrf1l UTSW 10 5817454 missense probably benign 0.01
R4618:Mtrf1l UTSW 10 5817586 missense probably benign 0.37
R4843:Mtrf1l UTSW 10 5823696 missense possibly damaging 0.56
R6034:Mtrf1l UTSW 10 5823834 unclassified probably benign
R6034:Mtrf1l UTSW 10 5823834 unclassified probably benign
R6261:Mtrf1l UTSW 10 5815550 critical splice donor site probably null
R6345:Mtrf1l UTSW 10 5817468 missense possibly damaging 0.96
R6991:Mtrf1l UTSW 10 5813384 missense probably damaging 1.00
R7669:Mtrf1l UTSW 10 5815620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACAATGGATTTGCACTAGAACG -3'
(R):5'- AAGTCTGTCTTCTCTGAAGCATACCCC -3'

Sequencing Primer
(F):5'- TACAAAGAAGCTTAGTCTCTTCTGG -3'
(R):5'- CATACCCCTATGTTATTTGGGGAGTC -3'
Posted On2013-11-08