Incidental Mutation 'R0866:H2-M11'
ID82367
Institutional Source Beutler Lab
Gene Symbol H2-M11
Ensembl Gene ENSMUSG00000037537
Gene Namehistocompatibility 2, M region locus 11
Synonyms
MMRRC Submission 039040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0866 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36547075-36549250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36548937 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 274 (L274P)
Ref Sequence ENSEMBL: ENSMUSP00000042522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041964]
Predicted Effect probably benign
Transcript: ENSMUST00000041964
AA Change: L274P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042522
Gene: ENSMUSG00000037537
AA Change: L274P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 2.8e-44 PFAM
IGc1 222 293 1.91e-18 SMART
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173968
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik G T 6: 131,552,779 R112L unknown Het
Abcd4 G T 12: 84,611,733 A232E probably damaging Het
Acsm5 T A 7: 119,540,900 I508N probably damaging Het
Adam22 T C 5: 8,082,156 Q263R probably damaging Het
Ccdc88c A G 12: 100,913,192 L1890P probably benign Het
Ckap4 C T 10: 84,527,520 D560N probably damaging Het
Crb3 T A 17: 57,062,743 L17Q probably damaging Het
Fbxo21 G T 5: 117,977,033 R78L probably benign Het
Gapvd1 A T 2: 34,709,217 C669S probably damaging Het
Gria2 A T 3: 80,722,024 probably benign Het
Hmox1 A G 8: 75,097,303 T200A probably benign Het
Hspa8 G A 9: 40,802,624 probably null Het
Isy1 C A 6: 87,819,112 R281L probably benign Het
Kiz C A 2: 146,856,053 probably benign Het
Lrig2 T C 3: 104,464,275 K704R probably benign Het
Lrp1 A T 10: 127,539,278 D4484E probably damaging Het
Lrrc7 C A 3: 158,164,266 probably benign Het
Mtmr14 T C 6: 113,239,582 probably null Het
Mtmr3 A T 11: 4,488,474 V660E probably benign Het
Mtor T C 4: 148,486,056 I1190T probably benign Het
Mtrf1l T C 10: 5,813,376 R318G probably damaging Het
Myh7 T C 14: 54,973,139 T1739A probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr186 C T 16: 59,027,428 V160I probably benign Het
Pcca A G 14: 122,889,545 E722G possibly damaging Het
Pds5b T A 5: 150,739,191 probably benign Het
Ralgapa2 A T 2: 146,436,003 F413I probably damaging Het
Rbbp9 T C 2: 144,550,708 Y24C probably damaging Het
Rgs2 A G 1: 144,002,250 S103P probably damaging Het
Rtn1 G T 12: 72,308,382 Y263* probably null Het
Slc22a1 T C 17: 12,657,046 E427G probably benign Het
Speg A G 1: 75,417,083 T1695A probably damaging Het
Tlx3 C A 11: 33,203,315 G49W probably damaging Het
Tor1b A G 2: 30,956,916 M292V probably benign Het
Tspyl3 A T 2: 153,224,934 L128Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfc3h1 G A 10: 115,427,716 V1821I probably benign Het
Zfhx4 A T 3: 5,412,212 T3271S possibly damaging Het
Zfp386 G T 12: 116,054,709 probably benign Het
Zfp574 A T 7: 25,079,898 K115M probably damaging Het
Other mutations in H2-M11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:H2-M11 APN 17 36547553 missense probably benign 0.00
IGL01657:H2-M11 APN 17 36547573 missense probably benign 0.00
IGL02249:H2-M11 APN 17 36547937 missense probably benign 0.39
IGL03263:H2-M11 APN 17 36548913 missense probably damaging 1.00
R0481:H2-M11 UTSW 17 36548954 nonsense probably null
R0639:H2-M11 UTSW 17 36547391 missense probably benign 0.00
R0924:H2-M11 UTSW 17 36549214 missense probably benign
R0925:H2-M11 UTSW 17 36547461 missense probably benign 0.00
R1707:H2-M11 UTSW 17 36548766 missense probably damaging 1.00
R2212:H2-M11 UTSW 17 36548930 missense probably damaging 1.00
R2566:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R2567:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3029:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3030:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3893:H2-M11 UTSW 17 36547090 missense probably benign 0.01
R3946:H2-M11 UTSW 17 36549231 missense probably damaging 1.00
R4647:H2-M11 UTSW 17 36547991 missense probably benign 0.06
R4679:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R4868:H2-M11 UTSW 17 36548919 missense probably damaging 1.00
R4876:H2-M11 UTSW 17 36547509 missense probably benign 0.09
R5496:H2-M11 UTSW 17 36547979 missense possibly damaging 0.73
R6514:H2-M11 UTSW 17 36548947 missense probably damaging 1.00
R7779:H2-M11 UTSW 17 36548806 missense probably benign 0.14
R8072:H2-M11 UTSW 17 36548134 missense probably benign 0.13
Z1176:H2-M11 UTSW 17 36548770 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGGGTTGACACCTCTTCCTCAAG -3'
(R):5'- TCTCCTGTGGCAGGGCATTTTC -3'

Sequencing Primer
(F):5'- TGATCCGTAAGGTCAGACCTG -3'
(R):5'- CAGGGCATTTTCACAGCTTAG -3'
Posted On2013-11-08