Incidental Mutation 'R0791:Mpz'
ID82378
Institutional Source Beutler Lab
Gene Symbol Mpz
Ensembl Gene ENSMUSG00000056569
Gene Namemyelin protein zero
SynonymsMpp, P0
MMRRC Submission 038971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0791 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171150711-171161130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 171158774 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 86 (Q86K)
Ref Sequence ENSEMBL: ENSMUSP00000106966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070758] [ENSMUST00000111334]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070758
AA Change: Q86K

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066701
Gene: ENSMUSG00000056569
AA Change: Q86K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGv 45 129 1.39e-11 SMART
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Myelin-PO_C 184 248 4.3e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111334
AA Change: Q86K

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106966
Gene: ENSMUSG00000056569
AA Change: Q86K

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
IGv 45 129 1.39e-11 SMART
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Myelin-PO_C 179 248 4.8e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149352
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in the orthologous gene in human are associated with myelinating neuropathies. A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit premature death, infertility, neurological behavior defects, and demyelination. Mice homozygous for a knock-out allele exhibit abnormal myelination and neurological behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Ahnak G A 19: 9,016,734 M5127I probably benign Het
Akr1c13 T C 13: 4,194,112 Y55H probably damaging Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bpifb2 T C 2: 153,878,519 V66A probably benign Het
Ccdc33 T C 9: 58,028,763 T950A possibly damaging Het
Ceacam19 A T 7: 19,882,632 probably null Het
Cenpn T A 8: 116,940,820 probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Clca1 A C 3: 145,004,854 S863A probably benign Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Dock4 C T 12: 40,704,481 R490W probably damaging Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Fbxw10 A G 11: 62,847,456 S59G probably benign Het
Glb1l2 A G 9: 26,769,751 V218A possibly damaging Het
Gpatch1 A T 7: 35,281,376 probably benign Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C A 17: 34,242,614 T109N probably damaging Het
Ipo8 A G 6: 148,821,727 V64A possibly damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Large1 A G 8: 73,048,479 probably benign Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Mrps24 A G 11: 5,704,684 V90A possibly damaging Het
Mtdh A G 15: 34,116,382 probably benign Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Mycbpap A G 11: 94,511,623 probably null Het
Myo6 T A 9: 80,262,374 probably benign Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Nbas T A 12: 13,482,633 S1781T probably benign Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Osbp2 G A 11: 3,711,882 probably benign Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Ptpn14 C T 1: 189,836,440 probably benign Het
Rims2 A G 15: 39,679,625 probably benign Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sema3g T A 14: 31,220,904 probably benign Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Slc5a1 T C 5: 33,158,077 probably benign Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Twnk T C 19: 45,010,254 probably benign Het
Tymp T C 15: 89,374,818 K221R probably damaging Het
Uaca C A 9: 60,872,059 Q1243K possibly damaging Het
Vwa8 T C 14: 78,994,576 probably benign Het
Wnt4 C T 4: 137,289,283 R83W probably damaging Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Zfp974 A T 7: 27,910,085 Y738* probably null Het
Zkscan4 A C 13: 21,483,911 E177D probably benign Het
Other mutations in Mpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Mpz APN 1 171160002 missense possibly damaging 0.84
IGL03051:Mpz APN 1 171158811 missense probably damaging 1.00
Half-pint UTSW 1 171159635 critical splice donor site probably null
taz UTSW 1 171158810 missense probably damaging 1.00
R0279:Mpz UTSW 1 171159929 splice site probably benign
R1164:Mpz UTSW 1 171158439 missense possibly damaging 0.92
R1368:Mpz UTSW 1 171159964 missense probably damaging 1.00
R4043:Mpz UTSW 1 171159771 splice site probably benign
R4857:Mpz UTSW 1 171158810 missense probably damaging 1.00
R5682:Mpz UTSW 1 171158894 missense possibly damaging 0.62
R6709:Mpz UTSW 1 171150732 unclassified probably benign
R7089:Mpz UTSW 1 171159635 critical splice donor site probably null
R7748:Mpz UTSW 1 171159940 critical splice acceptor site probably null
R7888:Mpz UTSW 1 171159635 critical splice donor site probably null
R7971:Mpz UTSW 1 171159635 critical splice donor site probably null
R8023:Mpz UTSW 1 171160033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCCAGTGAATGGGTCTCAGATG -3'
(R):5'- CCCTCTTTGAAATGCCTCCCAGAAC -3'

Sequencing Primer
(F):5'- GAATGGGTCTCAGATGACATCTC -3'
(R):5'- TTTCAAAGACATAGAGCGTGACC -3'
Posted On2013-11-08