Incidental Mutation 'R0791:Olfr477'
ID82395
Institutional Source Beutler Lab
Gene Symbol Olfr477
Ensembl Gene ENSMUSG00000096151
Gene Nameolfactory receptor 477
SynonymsGA_x6K02T2PBJ9-10319672-10320604, MOR204-1
MMRRC Submission 038971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R0791 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107986693-107992723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107990533 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 56 (H56R)
Ref Sequence ENSEMBL: ENSMUSP00000150605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091605] [ENSMUST00000214677]
Predicted Effect probably benign
Transcript: ENSMUST00000091605
AA Change: H56R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091654
Gene: ENSMUSG00000096151
AA Change: H56R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-52 PFAM
Pfam:7tm_1 41 290 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214677
AA Change: H56R

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Ahnak G A 19: 9,016,734 M5127I probably benign Het
Akr1c13 T C 13: 4,194,112 Y55H probably damaging Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bpifb2 T C 2: 153,878,519 V66A probably benign Het
Ccdc33 T C 9: 58,028,763 T950A possibly damaging Het
Ceacam19 A T 7: 19,882,632 probably null Het
Cenpn T A 8: 116,940,820 probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Clca1 A C 3: 145,004,854 S863A probably benign Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Dock4 C T 12: 40,704,481 R490W probably damaging Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Fbxw10 A G 11: 62,847,456 S59G probably benign Het
Glb1l2 A G 9: 26,769,751 V218A possibly damaging Het
Gpatch1 A T 7: 35,281,376 probably benign Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C A 17: 34,242,614 T109N probably damaging Het
Ipo8 A G 6: 148,821,727 V64A possibly damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Large1 A G 8: 73,048,479 probably benign Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Mpz C A 1: 171,158,774 Q86K possibly damaging Het
Mrps24 A G 11: 5,704,684 V90A possibly damaging Het
Mtdh A G 15: 34,116,382 probably benign Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Mycbpap A G 11: 94,511,623 probably null Het
Myo6 T A 9: 80,262,374 probably benign Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Nbas T A 12: 13,482,633 S1781T probably benign Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Osbp2 G A 11: 3,711,882 probably benign Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Ptpn14 C T 1: 189,836,440 probably benign Het
Rims2 A G 15: 39,679,625 probably benign Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sema3g T A 14: 31,220,904 probably benign Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Slc5a1 T C 5: 33,158,077 probably benign Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Twnk T C 19: 45,010,254 probably benign Het
Tymp T C 15: 89,374,818 K221R probably damaging Het
Uaca C A 9: 60,872,059 Q1243K possibly damaging Het
Vwa8 T C 14: 78,994,576 probably benign Het
Wnt4 C T 4: 137,289,283 R83W probably damaging Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Zfp974 A T 7: 27,910,085 Y738* probably null Het
Zkscan4 A C 13: 21,483,911 E177D probably benign Het
Other mutations in Olfr477
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Olfr477 APN 7 107990890 missense probably damaging 0.97
IGL01078:Olfr477 APN 7 107990943 missense probably benign 0.02
IGL01141:Olfr477 APN 7 107990551 missense probably damaging 1.00
IGL02613:Olfr477 APN 7 107991174 nonsense probably null
R0625:Olfr477 UTSW 7 107991189 missense probably damaging 1.00
R1254:Olfr477 UTSW 7 107990440 missense probably benign 0.01
R1456:Olfr477 UTSW 7 107990398 missense probably benign 0.06
R1522:Olfr477 UTSW 7 107990533 missense probably benign 0.27
R1541:Olfr477 UTSW 7 107990841 missense probably benign 0.10
R2889:Olfr477 UTSW 7 107990577 missense probably benign 0.06
R5653:Olfr477 UTSW 7 107990385 missense probably benign 0.38
R6146:Olfr477 UTSW 7 107990413 missense probably damaging 1.00
R6190:Olfr477 UTSW 7 107991100 missense probably damaging 1.00
R7103:Olfr477 UTSW 7 107990598 missense possibly damaging 0.92
R7191:Olfr477 UTSW 7 107990646 missense possibly damaging 0.88
R7553:Olfr477 UTSW 7 107990475 missense probably benign 0.03
R7681:Olfr477 UTSW 7 107991148 missense possibly damaging 0.80
Z1088:Olfr477 UTSW 7 107990731 missense probably benign 0.42
Z1177:Olfr477 UTSW 7 107991094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATGGAGGCTCAAAACCACAC -3'
(R):5'- TTCAGCACAGCAGGGAAGTCAC -3'

Sequencing Primer
(F):5'- CACCACTGTGAAAGAATTCATCC -3'
(R):5'- CTATCTGATTTGGTCCACAGAAGG -3'
Posted On2013-11-08