Mutagenetix > Incidental Mutations

Incidental Mutation 'R0791:Large1'

82398

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

038971-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.453) question?

Stock #

R0791 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 73048479 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably benign
Transcript: ENSMUST00000004497

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119826

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146249

Predicted Effect

probably benign
Transcript: ENSMUST00000212459

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.8%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	T	19: 45,933,868		probably null	Het
Ahnak	G	A	19: 9,016,734	M5127I	probably benign	Het
Akr1c13	T	C	13: 4,194,112	Y55H	probably damaging	Het
Atp2b2	C	T	6: 113,773,388	R625H	probably damaging	Het
Bpifb2	T	C	2: 153,878,519	V66A	probably benign	Het
Ccdc33	T	C	9: 58,028,763	T950A	possibly damaging	Het
Ceacam19	A	T	7: 19,882,632		probably null	Het
Cenpn	T	A	8: 116,940,820		probably benign	Het
Ces1f	A	T	8: 93,271,889	Y160N	possibly damaging	Het
Clca1	A	C	3: 145,004,854	S863A	probably benign	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Dock4	C	T	12: 40,704,481	R490W	probably damaging	Het
Evpl	T	A	11: 116,227,723	Q686L	probably damaging	Het
Fbxw10	A	G	11: 62,847,456	S59G	probably benign	Het
Glb1l2	A	G	9: 26,769,751	V218A	possibly damaging	Het
Gpatch1	A	T	7: 35,281,376		probably benign	Het
Grin2c	G	A	11: 115,250,646	P882L	probably damaging	Het
H2-Ob	C	A	17: 34,242,614	T109N	probably damaging	Het
Ipo8	A	G	6: 148,821,727	V64A	possibly damaging	Het
Jpt2	C	A	17: 24,948,673	A101S	probably benign	Het
Lamc1	C	A	1: 153,234,580	Q1116H	possibly damaging	Het
Lamc1	T	G	1: 153,234,595	Q1111H	probably damaging	Het
Lamc1	T	C	1: 153,234,612	S1106G	probably benign	Het
Lig4	A	T	8: 9,973,012	V256E	possibly damaging	Het
Mpz	C	A	1: 171,158,774	Q86K	possibly damaging	Het
Mrps24	A	G	11: 5,704,684	V90A	possibly damaging	Het
Mtdh	A	G	15: 34,116,382		probably benign	Het
Mtor	T	C	4: 148,462,910	V450A	probably benign	Het
Mycbpap	A	G	11: 94,511,623		probably null	Het
Myo6	T	A	9: 80,262,374		probably benign	Het
Myom1	A	T	17: 71,121,136	I1450F	probably damaging	Het
Nbas	T	A	12: 13,482,633	S1781T	probably benign	Het
Nedd1	T	C	10: 92,719,614	E3G	probably damaging	Het
Nt5c3	T	C	6: 56,886,749	T149A	probably benign	Het
Olfr477	A	G	7: 107,990,533	H56R	probably benign	Het
Osbp2	G	A	11: 3,711,882		probably benign	Het
Paip1	T	C	13: 119,430,318	S54P	possibly damaging	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Prdm14	G	T	1: 13,125,744	A31E	probably benign	Het
Ptpn14	C	T	1: 189,836,440		probably benign	Het
Rims2	A	G	15: 39,679,625		probably benign	Het
Rnf20	A	G	4: 49,638,197	N103S	possibly damaging	Het
Sema3g	T	A	14: 31,220,904		probably benign	Het
Slc30a6	T	C	17: 74,415,645	S236P	possibly damaging	Het
Slc5a1	T	C	5: 33,158,077		probably benign	Het
Snx25	A	T	8: 46,124,082	M1K	probably null	Het
Synpo2	A	G	3: 123,113,186	V827A	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trak2	A	T	1: 58,903,661	M862K	probably benign	Het
Trim42	A	T	9: 97,365,679	H321Q	probably damaging	Het
Twnk	T	C	19: 45,010,254		probably benign	Het
Tymp	T	C	15: 89,374,818	K221R	probably damaging	Het
Uaca	C	A	9: 60,872,059	Q1243K	possibly damaging	Het
Vwa8	T	C	14: 78,994,576		probably benign	Het
Wnt4	C	T	4: 137,289,283	R83W	probably damaging	Het
Zfp820	T	C	17: 21,819,528	D273G	probably benign	Het
Zfp974	A	T	7: 27,910,085	Y738*	probably null	Het
Zkscan4	A	C	13: 21,483,911	E177D	probably benign	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0477:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R0587:Large1	UTSW	8	72859333	missense	probably damaging	1.00
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R1695:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5120:Large1	UTSW	8	72859341	missense	probably damaging	1.00
R5135:Large1	UTSW	8	72818096	missense	probably benign	0.38
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R5945:Large1	UTSW	8	72852200	missense	probably damaging	0.99
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7300:Large1	UTSW	8	72837596	missense	probably damaging	1.00
R7493:Large1	UTSW	8	72823715	missense	probably benign	0.23
R7877:Large1	UTSW	8	73116443	missense	probably damaging	1.00
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8129:Large1	UTSW	8	72815957	missense	probably damaging	1.00
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTCTGCAATGTCTGTTGCAAAGG -3'
(R):5'- GGAAGCACTCACACTAACTTAGCCG -3'

Sequencing Primer
(F):5'- CTGTTGCAAAGGTGATGTCGG -3'
(R):5'- TGCTAATAGCAATAAAGCCTGTC -3'

Posted On

2013-11-08