Incidental Mutation 'R0791:Ces1f'
ID82399
Institutional Source Beutler Lab
Gene Symbol Ces1f
Ensembl Gene ENSMUSG00000031725
Gene Namecarboxylesterase 1F
SynonymsTGH-2, CesML1
MMRRC Submission 038971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0791 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93256236-93279747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93271889 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 160 (Y160N)
Ref Sequence ENSEMBL: ENSMUSP00000034178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034178] [ENSMUST00000140026]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034178
AA Change: Y160N

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034178
Gene: ENSMUSG00000031725
AA Change: Y160N

DomainStartEndE-ValueType
Pfam:COesterase 1 545 2.5e-166 PFAM
Pfam:Abhydrolase_3 136 244 4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133879
Predicted Effect probably benign
Transcript: ENSMUST00000140026
SMART Domains Protein: ENSMUSP00000116525
Gene: ENSMUSG00000031725

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151261
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Ahnak G A 19: 9,016,734 M5127I probably benign Het
Akr1c13 T C 13: 4,194,112 Y55H probably damaging Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bpifb2 T C 2: 153,878,519 V66A probably benign Het
Ccdc33 T C 9: 58,028,763 T950A possibly damaging Het
Ceacam19 A T 7: 19,882,632 probably null Het
Cenpn T A 8: 116,940,820 probably benign Het
Clca1 A C 3: 145,004,854 S863A probably benign Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Dock4 C T 12: 40,704,481 R490W probably damaging Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Fbxw10 A G 11: 62,847,456 S59G probably benign Het
Glb1l2 A G 9: 26,769,751 V218A possibly damaging Het
Gpatch1 A T 7: 35,281,376 probably benign Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C A 17: 34,242,614 T109N probably damaging Het
Ipo8 A G 6: 148,821,727 V64A possibly damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Large1 A G 8: 73,048,479 probably benign Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Mpz C A 1: 171,158,774 Q86K possibly damaging Het
Mrps24 A G 11: 5,704,684 V90A possibly damaging Het
Mtdh A G 15: 34,116,382 probably benign Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Mycbpap A G 11: 94,511,623 probably null Het
Myo6 T A 9: 80,262,374 probably benign Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Nbas T A 12: 13,482,633 S1781T probably benign Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Osbp2 G A 11: 3,711,882 probably benign Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Ptpn14 C T 1: 189,836,440 probably benign Het
Rims2 A G 15: 39,679,625 probably benign Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sema3g T A 14: 31,220,904 probably benign Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Slc5a1 T C 5: 33,158,077 probably benign Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Twnk T C 19: 45,010,254 probably benign Het
Tymp T C 15: 89,374,818 K221R probably damaging Het
Uaca C A 9: 60,872,059 Q1243K possibly damaging Het
Vwa8 T C 14: 78,994,576 probably benign Het
Wnt4 C T 4: 137,289,283 R83W probably damaging Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Zfp974 A T 7: 27,910,085 Y738* probably null Het
Zkscan4 A C 13: 21,483,911 E177D probably benign Het
Other mutations in Ces1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ces1f APN 8 93267992 missense probably benign
IGL01143:Ces1f APN 8 93271830 critical splice donor site probably null
IGL01571:Ces1f APN 8 93258368 missense probably benign 0.00
IGL01731:Ces1f APN 8 93267320 missense possibly damaging 0.73
IGL01733:Ces1f APN 8 93270014 missense probably damaging 1.00
IGL02124:Ces1f APN 8 93265860 missense possibly damaging 0.54
IGL03058:Ces1f APN 8 93269972 critical splice donor site probably null
IGL03124:Ces1f APN 8 93275384 missense probably benign
3-1:Ces1f UTSW 8 93275431 missense probably benign 0.29
G5030:Ces1f UTSW 8 93274219 missense probably benign 0.03
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0113:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R0201:Ces1f UTSW 8 93267329 missense probably null 0.01
R0306:Ces1f UTSW 8 93276544 splice site probably benign
R0317:Ces1f UTSW 8 93263391 missense probably benign 0.05
R0558:Ces1f UTSW 8 93275389 missense probably benign
R0833:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R0836:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R1087:Ces1f UTSW 8 93258295 missense probably damaging 1.00
R1118:Ces1f UTSW 8 93267242 splice site probably benign
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1183:Ces1f UTSW 8 93268005 missense probably benign 0.01
R1371:Ces1f UTSW 8 93279649 missense probably damaging 0.98
R1480:Ces1f UTSW 8 93274154 missense probably benign 0.07
R1522:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R1681:Ces1f UTSW 8 93275414 missense probably benign 0.00
R1865:Ces1f UTSW 8 93274265 splice site probably benign
R2437:Ces1f UTSW 8 93270139 splice site probably null
R3038:Ces1f UTSW 8 93256598 missense probably damaging 1.00
R4199:Ces1f UTSW 8 93256889 missense probably benign 0.00
R4406:Ces1f UTSW 8 93263322 missense probably benign
R5385:Ces1f UTSW 8 93265760 nonsense probably null
R5450:Ces1f UTSW 8 93265795 missense probably benign 0.04
R5627:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R6182:Ces1f UTSW 8 93256496 missense probably benign 0.43
R6256:Ces1f UTSW 8 93265794 missense probably damaging 1.00
R6379:Ces1f UTSW 8 93279651 missense probably benign
R6443:Ces1f UTSW 8 93275365 missense probably benign 0.00
R6967:Ces1f UTSW 8 93267997 missense probably benign 0.00
R7158:Ces1f UTSW 8 93268016 missense probably benign 0.00
R7323:Ces1f UTSW 8 93271844 missense probably damaging 1.00
R7654:Ces1f UTSW 8 93271934 missense probably benign 0.00
R7810:Ces1f UTSW 8 93256918 missense probably damaging 1.00
R7812:Ces1f UTSW 8 93258310 missense probably benign 0.00
R7864:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7947:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7999:Ces1f UTSW 8 93262995 missense possibly damaging 0.77
X0026:Ces1f UTSW 8 93270056 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATGCAGTCCTTGGTATCCCACCAC -3'
(R):5'- GGTGAACTTTGAGCATCATGCCCTG -3'

Sequencing Primer
(F):5'- TTGGTATCCCACCACTCCAAAC -3'
(R):5'- ATCAGGGCCAGGCCAAG -3'
Posted On2013-11-08