Incidental Mutation 'R0791:Uaca'
ID82403
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Nameuveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms2700059D02Rik, nucling
MMRRC Submission 038971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0791 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location60794542-60880370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60872059 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1243 (Q1243K)
Ref Sequence ENSEMBL: ENSMUSP00000062047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050183
AA Change: Q1243K

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: Q1243K

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214354
AA Change: Q1241K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216574
Predicted Effect unknown
Transcript: ENSMUST00000217656
AA Change: Q1065K
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Ahnak G A 19: 9,016,734 M5127I probably benign Het
Akr1c13 T C 13: 4,194,112 Y55H probably damaging Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bpifb2 T C 2: 153,878,519 V66A probably benign Het
Ccdc33 T C 9: 58,028,763 T950A possibly damaging Het
Ceacam19 A T 7: 19,882,632 probably null Het
Cenpn T A 8: 116,940,820 probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Clca1 A C 3: 145,004,854 S863A probably benign Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Dock4 C T 12: 40,704,481 R490W probably damaging Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Fbxw10 A G 11: 62,847,456 S59G probably benign Het
Glb1l2 A G 9: 26,769,751 V218A possibly damaging Het
Gpatch1 A T 7: 35,281,376 probably benign Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C A 17: 34,242,614 T109N probably damaging Het
Ipo8 A G 6: 148,821,727 V64A possibly damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Large1 A G 8: 73,048,479 probably benign Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Mpz C A 1: 171,158,774 Q86K possibly damaging Het
Mrps24 A G 11: 5,704,684 V90A possibly damaging Het
Mtdh A G 15: 34,116,382 probably benign Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Mycbpap A G 11: 94,511,623 probably null Het
Myo6 T A 9: 80,262,374 probably benign Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Nbas T A 12: 13,482,633 S1781T probably benign Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Osbp2 G A 11: 3,711,882 probably benign Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Ptpn14 C T 1: 189,836,440 probably benign Het
Rims2 A G 15: 39,679,625 probably benign Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sema3g T A 14: 31,220,904 probably benign Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Slc5a1 T C 5: 33,158,077 probably benign Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Twnk T C 19: 45,010,254 probably benign Het
Tymp T C 15: 89,374,818 K221R probably damaging Het
Vwa8 T C 14: 78,994,576 probably benign Het
Wnt4 C T 4: 137,289,283 R83W probably damaging Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Zfp974 A T 7: 27,910,085 Y738* probably null Het
Zkscan4 A C 13: 21,483,911 E177D probably benign Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60872225 missense probably benign
IGL01751:Uaca APN 9 60869857 missense probably damaging 1.00
IGL02868:Uaca APN 9 60863637 missense probably damaging 1.00
IGL02977:Uaca APN 9 60866380 missense probably benign 0.00
IGL03037:Uaca APN 9 60840865 missense probably damaging 1.00
IGL03060:Uaca APN 9 60869866 missense probably damaging 1.00
IGL03083:Uaca APN 9 60863663 missense probably benign 0.28
IGL03266:Uaca APN 9 60863407 missense probably damaging 1.00
IGL03346:Uaca APN 9 60854318 missense probably damaging 1.00
Ixtapa UTSW 9 60870413 missense probably damaging 0.99
oaxaca UTSW 9 60871451 missense probably benign
R0408:Uaca UTSW 9 60871859 missense possibly damaging 0.71
R0567:Uaca UTSW 9 60871381 missense probably benign 0.01
R0598:Uaca UTSW 9 60870921 nonsense probably null
R0603:Uaca UTSW 9 60871097 missense possibly damaging 0.60
R0655:Uaca UTSW 9 60872029 missense probably benign 0.03
R0707:Uaca UTSW 9 60848618 splice site probably benign
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1520:Uaca UTSW 9 60871381 missense probably benign 0.30
R1673:Uaca UTSW 9 60872156 missense probably damaging 1.00
R1894:Uaca UTSW 9 60870436 missense possibly damaging 0.87
R1997:Uaca UTSW 9 60870341 missense probably damaging 1.00
R2042:Uaca UTSW 9 60869891 missense probably damaging 1.00
R2095:Uaca UTSW 9 60840843 missense probably benign 0.00
R2148:Uaca UTSW 9 60869679 missense probably damaging 1.00
R2384:Uaca UTSW 9 60869917 missense probably damaging 1.00
R3110:Uaca UTSW 9 60871499 missense probably damaging 1.00
R3112:Uaca UTSW 9 60871499 missense probably damaging 1.00
R4001:Uaca UTSW 9 60871084 missense probably benign 0.04
R4155:Uaca UTSW 9 60871753 missense probably benign 0.02
R4156:Uaca UTSW 9 60871753 missense probably benign 0.02
R4157:Uaca UTSW 9 60871753 missense probably benign 0.02
R4410:Uaca UTSW 9 60869891 missense probably damaging 1.00
R4674:Uaca UTSW 9 60854429 missense possibly damaging 0.94
R4871:Uaca UTSW 9 60846001 missense probably damaging 1.00
R5130:Uaca UTSW 9 60880228 missense probably damaging 0.96
R5328:Uaca UTSW 9 60870532 missense probably benign 0.44
R5358:Uaca UTSW 9 60871148 missense probably benign
R5415:Uaca UTSW 9 60870139 missense possibly damaging 0.65
R5437:Uaca UTSW 9 60871451 missense probably benign
R5647:Uaca UTSW 9 60872098 missense probably benign 0.28
R5710:Uaca UTSW 9 60871811 missense probably damaging 1.00
R5920:Uaca UTSW 9 60869603 missense probably benign 0.19
R5931:Uaca UTSW 9 60872012 missense probably damaging 0.97
R5933:Uaca UTSW 9 60840956 missense probably damaging 1.00
R5959:Uaca UTSW 9 60870770 missense probably damaging 1.00
R6193:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6195:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6242:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6243:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6244:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6274:Uaca UTSW 9 60850291 splice site probably null
R6670:Uaca UTSW 9 60872024 missense probably benign 0.09
R6883:Uaca UTSW 9 60869891 missense probably damaging 1.00
R7011:Uaca UTSW 9 60870368 missense probably damaging 1.00
R7111:Uaca UTSW 9 60871838 missense probably benign 0.06
R7146:Uaca UTSW 9 60870413 missense probably damaging 0.99
R7424:Uaca UTSW 9 60870110 missense probably damaging 1.00
R7485:Uaca UTSW 9 60846000 missense probably damaging 1.00
R7510:Uaca UTSW 9 60850205 splice site probably null
R7688:Uaca UTSW 9 60874127 missense probably benign 0.11
R7724:Uaca UTSW 9 60869905 missense probably benign 0.24
R7743:Uaca UTSW 9 60876395 missense probably damaging 0.99
R8556:Uaca UTSW 9 60870641 missense probably damaging 0.97
R8699:Uaca UTSW 9 60871065 missense probably damaging 1.00
R8814:Uaca UTSW 9 60866398 missense possibly damaging 0.82
R8828:Uaca UTSW 9 60871570 missense probably benign 0.00
X0067:Uaca UTSW 9 60859149 missense possibly damaging 0.69
Z1177:Uaca UTSW 9 60874123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGAAGAACTCCTCGGTGACCC -3'
(R):5'- AATGGCTTGGTAGACCGGACTGTG -3'

Sequencing Primer
(F):5'- TGAAGCTAAAGGAAGCCCTC -3'
(R):5'- TTCTGTGCTAAGGAGCCAC -3'
Posted On2013-11-08