Incidental Mutation 'R0791:Akr1c13'
ID82417
Institutional Source Beutler Lab
Gene Symbol Akr1c13
Ensembl Gene ENSMUSG00000021213
Gene Namealdo-keto reductase family 1, member C13
Synonyms
MMRRC Submission 038971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0791 (G1)
Quality Score146
Status Not validated
Chromosome13
Chromosomal Location4191150-4205596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4194112 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 55 (Y55H)
Ref Sequence ENSEMBL: ENSMUSP00000021634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021634] [ENSMUST00000128892]
PDB Structure Crystal structure of Putative reductase (NP_038806.2) from MUS MUSCULUS at 1.18 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021634
AA Change: Y55H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021634
Gene: ENSMUSG00000021213
AA Change: Y55H

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 7.8e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140971
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Ahnak G A 19: 9,016,734 M5127I probably benign Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bpifb2 T C 2: 153,878,519 V66A probably benign Het
Ccdc33 T C 9: 58,028,763 T950A possibly damaging Het
Ceacam19 A T 7: 19,882,632 probably null Het
Cenpn T A 8: 116,940,820 probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Clca1 A C 3: 145,004,854 S863A probably benign Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Dock4 C T 12: 40,704,481 R490W probably damaging Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Fbxw10 A G 11: 62,847,456 S59G probably benign Het
Glb1l2 A G 9: 26,769,751 V218A possibly damaging Het
Gpatch1 A T 7: 35,281,376 probably benign Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C A 17: 34,242,614 T109N probably damaging Het
Ipo8 A G 6: 148,821,727 V64A possibly damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Large1 A G 8: 73,048,479 probably benign Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Mpz C A 1: 171,158,774 Q86K possibly damaging Het
Mrps24 A G 11: 5,704,684 V90A possibly damaging Het
Mtdh A G 15: 34,116,382 probably benign Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Mycbpap A G 11: 94,511,623 probably null Het
Myo6 T A 9: 80,262,374 probably benign Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Nbas T A 12: 13,482,633 S1781T probably benign Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Osbp2 G A 11: 3,711,882 probably benign Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Ptpn14 C T 1: 189,836,440 probably benign Het
Rims2 A G 15: 39,679,625 probably benign Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sema3g T A 14: 31,220,904 probably benign Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Slc5a1 T C 5: 33,158,077 probably benign Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Synpo2 A G 3: 123,113,186 V827A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Twnk T C 19: 45,010,254 probably benign Het
Tymp T C 15: 89,374,818 K221R probably damaging Het
Uaca C A 9: 60,872,059 Q1243K possibly damaging Het
Vwa8 T C 14: 78,994,576 probably benign Het
Wnt4 C T 4: 137,289,283 R83W probably damaging Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Zfp974 A T 7: 27,910,085 Y738* probably null Het
Zkscan4 A C 13: 21,483,911 E177D probably benign Het
Other mutations in Akr1c13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Akr1c13 APN 13 4197795 splice site probably null
IGL01553:Akr1c13 APN 13 4194775 missense probably damaging 1.00
IGL01895:Akr1c13 APN 13 4205373 missense possibly damaging 0.53
IGL02029:Akr1c13 APN 13 4205362 nonsense probably null
IGL02316:Akr1c13 APN 13 4203459 unclassified probably benign
IGL02949:Akr1c13 APN 13 4198594 missense probably damaging 0.99
R0050:Akr1c13 UTSW 13 4194670 splice site probably benign
R0184:Akr1c13 UTSW 13 4194056 missense probably damaging 0.98
R0470:Akr1c13 UTSW 13 4198501 missense probably damaging 1.00
R0722:Akr1c13 UTSW 13 4197932 splice site probably null
R0792:Akr1c13 UTSW 13 4194112 missense probably damaging 1.00
R2106:Akr1c13 UTSW 13 4198594 missense probably damaging 0.99
R2509:Akr1c13 UTSW 13 4198584 missense probably damaging 1.00
R4624:Akr1c13 UTSW 13 4197870 missense probably damaging 1.00
R4626:Akr1c13 UTSW 13 4197870 missense probably damaging 1.00
R4627:Akr1c13 UTSW 13 4197870 missense probably damaging 1.00
R4628:Akr1c13 UTSW 13 4197870 missense probably damaging 1.00
R4629:Akr1c13 UTSW 13 4197870 missense probably damaging 1.00
R4764:Akr1c13 UTSW 13 4198497 missense probably benign 0.05
R5112:Akr1c13 UTSW 13 4194152 missense possibly damaging 0.70
R5149:Akr1c13 UTSW 13 4194169 missense probably benign 0.10
R5203:Akr1c13 UTSW 13 4197897 nonsense probably null
R5408:Akr1c13 UTSW 13 4194716 missense probably benign 0.00
R5776:Akr1c13 UTSW 13 4194187 missense probably damaging 1.00
R6469:Akr1c13 UTSW 13 4196512 critical splice donor site probably null
R7466:Akr1c13 UTSW 13 4192437 critical splice donor site probably benign
X0020:Akr1c13 UTSW 13 4203451 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGGTACTAGGCTCTTTCCTAACAACT -3'
(R):5'- GCACCAAAGCTACAGATGTTGAAGACT -3'

Sequencing Primer
(F):5'- CTGTTGTTAGGATGACTTTGAAAGAC -3'
(R):5'- TGAAGGAAGGTTATAAGAATCCCTC -3'
Posted On2013-11-08