Incidental Mutation 'R0792:Olfr510'
ID82457
Institutional Source Beutler Lab
Gene Symbol Olfr510
Ensembl Gene ENSMUSG00000096209
Gene Nameolfactory receptor 510
SynonymsMOR204-34, GA_x6K02T2PBJ9-10997715-10998659
MMRRC Submission 038972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0792 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108666418-108670259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108668157 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 247 (H247R)
Ref Sequence ENSEMBL: ENSMUSP00000149693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076289] [ENSMUST00000213979] [ENSMUST00000216331] [ENSMUST00000217170]
Predicted Effect probably damaging
Transcript: ENSMUST00000076289
AA Change: H247R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075637
Gene: ENSMUSG00000096209
AA Change: H247R

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 3e-50 PFAM
Pfam:7tm_1 44 293 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210621
AA Change: H247R
Predicted Effect probably damaging
Transcript: ENSMUST00000213979
AA Change: H247R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216331
AA Change: H247R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217170
AA Change: H247R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ahnak G T 19: 9,016,734 M5127I probably benign Het
Akr1c13 T C 13: 4,194,112 Y55H probably damaging Het
Ap3d1 A T 10: 80,708,479 H1161Q probably benign Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bdnf G A 2: 109,724,118 C239Y probably damaging Het
Bpifa5 G T 2: 154,165,619 probably null Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Cep68 A T 11: 20,240,652 L120H possibly damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Cpne1 G T 2: 156,077,419 Q343K probably benign Het
D3Ertd254e A G 3: 36,164,562 M244V probably benign Het
Dlc1 A T 8: 36,938,548 I29K probably benign Het
Dnah9 T C 11: 65,896,001 D3602G possibly damaging Het
Dock1 A G 7: 134,874,150 S885G probably benign Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Fmo6 C T 1: 162,920,563 A311T probably damaging Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C T 17: 34,242,614 T109I probably damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Krt2 A G 15: 101,816,497 V226A probably damaging Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Ltbp4 G T 7: 27,325,060 P715Q probably damaging Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Naip6 A G 13: 100,283,766 I1332T possibly damaging Het
Ncstn A G 1: 172,071,505 V353A possibly damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Olfr203 A T 16: 59,303,989 I280F probably damaging Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Prr14l A G 5: 32,828,423 S1243P probably damaging Het
Prss1 T C 6: 41,458,944 M1T probably null Het
Raver2 T A 4: 101,102,950 V209D probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Slc16a13 A T 11: 70,220,631 V16E probably damaging Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Sobp A C 10: 43,022,693 S299A probably damaging Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Ubox5 A T 2: 130,600,710 V19E probably damaging Het
Vmn1r173 A G 7: 23,702,735 T132A probably benign Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Other mutations in Olfr510
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Olfr510 APN 7 108667700 missense possibly damaging 0.61
IGL00952:Olfr510 APN 7 108668238 missense possibly damaging 0.89
IGL01358:Olfr510 APN 7 108667662 missense possibly damaging 0.90
IGL01663:Olfr510 APN 7 108667891 missense probably benign 0.01
IGL02686:Olfr510 APN 7 108667886 missense probably benign 0.00
PIT4466001:Olfr510 UTSW 7 108667536 missense possibly damaging 0.52
R0095:Olfr510 UTSW 7 108668045 missense probably benign 0.00
R0095:Olfr510 UTSW 7 108668045 missense probably benign 0.00
R0925:Olfr510 UTSW 7 108668193 missense probably benign 0.00
R1829:Olfr510 UTSW 7 108667644 missense probably benign 0.24
R2092:Olfr510 UTSW 7 108667662 frame shift probably null
R2483:Olfr510 UTSW 7 108667662 frame shift probably null
R3619:Olfr510 UTSW 7 108667850 missense probably benign 0.00
R4386:Olfr510 UTSW 7 108668253 missense probably damaging 0.99
R5298:Olfr510 UTSW 7 108668072 missense probably benign 0.00
R5622:Olfr510 UTSW 7 108668082 missense probably benign
R6079:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
R6138:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
R8359:Olfr510 UTSW 7 108668311 missense probably benign 0.00
U15987:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
Z1177:Olfr510 UTSW 7 108667836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGTGGCAATCTGCAATCCACTG -3'
(R):5'- CCAAGCTGTTTCTTCAGAGCACCC -3'

Sequencing Primer
(F):5'- CCAAACAAGTGTGTATCCAATTGC -3'
(R):5'- AGAGCACCCTTAATCTCATTATTCC -3'
Posted On2013-11-08