Mutagenetix > Incidental Mutation

Incidental Mutation 'R0792:Muc6'

82459

Institutional Source

Beutler Lab

Gene Symbol

Muc6

Ensembl Gene

ENSMUSG00000048191

Gene Name

mucin 6, gastric

Synonyms

MMRRC Submission

038972-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R0792 (G1)

Quality Score

116

Status

Not validated

Chromosome

Chromosomal Location

141633456-141655319 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 141639559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000062451
AA Change: L1669F

SMART Domains

Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: L1669F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	2.49e-14	SMART
C8	267	340	5.46e-3	SMART
Pfam:TIL	344	399	5.6e-14	PFAM
VWC	401	469	2.57e-7	SMART
VWD	428	591	4.81e-30	SMART
C8	627	703	8.84e-21	SMART
SCOP:d1coua_	706	769	7e-9	SMART
Pfam:TIL	806	869	1.9e-9	PFAM
VWC	871	941	8.52e-3	SMART
VWD	898	1060	1.59e-30	SMART
C8	1096	1170	5.52e-31	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
internal_repeat_3	1375	1560	6.78e-17	PROSPERO
internal_repeat_2	1426	1751	8.94e-34	PROSPERO
low complexity region	1761	1780	N/A	INTRINSIC
low complexity region	1867	1887	N/A	INTRINSIC
low complexity region	1896	1910	N/A	INTRINSIC
low complexity region	1912	1946	N/A	INTRINSIC
low complexity region	1990	2004	N/A	INTRINSIC
low complexity region	2010	2020	N/A	INTRINSIC
internal_repeat_2	2036	2430	8.94e-34	PROSPERO
internal_repeat_3	2329	2516	6.78e-17	PROSPERO
low complexity region	2519	2536	N/A	INTRINSIC
low complexity region	2564	2587	N/A	INTRINSIC
low complexity region	2605	2630	N/A	INTRINSIC
low complexity region	2642	2677	N/A	INTRINSIC
low complexity region	2729	2762	N/A	INTRINSIC
Blast:CT	2765	2852	1e-44	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000189314

SMART Domains

Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	193	2.64e-27	SMART
C8	226	299	5.46e-3	SMART
Pfam:TIL	303	358	1.4e-13	PFAM
VWC	360	428	2.57e-7	SMART
VWD	387	550	4.81e-30	SMART
C8	586	662	8.84e-21	SMART
internal_repeat_2	665	754	5.76e-7	PROSPERO
Pfam:TIL	765	828	6.4e-9	PFAM
VWC	830	900	8.52e-3	SMART
VWD	857	1019	1.59e-30	SMART
C8	1055	1129	5.52e-31	SMART
low complexity region	1199	1228	N/A	INTRINSIC
low complexity region	1234	1252	N/A	INTRINSIC
low complexity region	1272	1296	N/A	INTRINSIC
low complexity region	1304	1333	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000190907
AA Change: L1734F

SMART Domains

Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: L1734F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	1.2e-16	SMART
C8	267	340	4.2e-7	SMART
Pfam:TIL	344	399	7.2e-11	PFAM
VWC_def	401	469	1.2e-9	SMART
VWD	428	591	2.4e-32	SMART
C8	627	703	6.7e-25	SMART
SCOP:d1coua_	706	769	5e-9	SMART
Pfam:TIL	806	869	3.3e-6	PFAM
VWC_def	871	941	4.1e-5	SMART
VWD	898	1060	7.7e-33	SMART
C8	1096	1170	4.2e-35	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
low complexity region	1406	1419	N/A	INTRINSIC
internal_repeat_1	1426	1822	3.44e-48	PROSPERO
low complexity region	1826	1845	N/A	INTRINSIC
low complexity region	1932	1952	N/A	INTRINSIC
low complexity region	1961	1975	N/A	INTRINSIC
low complexity region	1977	2011	N/A	INTRINSIC
low complexity region	2055	2069	N/A	INTRINSIC
low complexity region	2075	2085	N/A	INTRINSIC
internal_repeat_1	2101	2501	3.44e-48	PROSPERO
low complexity region	2504	2524	N/A	INTRINSIC
low complexity region	2584	2601	N/A	INTRINSIC
low complexity region	2629	2652	N/A	INTRINSIC
low complexity region	2670	2695	N/A	INTRINSIC
low complexity region	2707	2742	N/A	INTRINSIC
low complexity region	2794	2827	N/A	INTRINSIC
Blast:CT	2830	2917	1e-44	BLAST

Meta Mutation Damage Score

0.0709

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.6%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	T	19: 45,933,868		probably null	Het
Acsl5	T	C	19: 55,280,492	V195A	probably benign	Het
Adgrb1	A	G	15: 74,580,617	M211V	probably damaging	Het
Ahnak	G	T	19: 9,016,734	M5127I	probably benign	Het
Akr1c13	T	C	13: 4,194,112	Y55H	probably damaging	Het
Ap3d1	A	T	10: 80,708,479	H1161Q	probably benign	Het
Atp2b2	C	T	6: 113,773,388	R625H	probably damaging	Het
Bdnf	G	A	2: 109,724,118	C239Y	probably damaging	Het
Bpifa5	G	T	2: 154,165,619		probably null	Het
C9	T	A	15: 6,486,762	F349I	probably damaging	Het
Ccdc180	T	C	4: 45,927,975	V1170A	possibly damaging	Het
Celsr1	A	G	15: 85,931,276	V1846A	probably benign	Het
Cep68	A	T	11: 20,240,652	L120H	possibly damaging	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Cpne1	G	T	2: 156,077,419	Q343K	probably benign	Het
D3Ertd254e	A	G	3: 36,164,562	M244V	probably benign	Het
Dlc1	A	T	8: 36,938,548	I29K	probably benign	Het
Dnah9	T	C	11: 65,896,001	D3602G	possibly damaging	Het
Dock1	A	G	7: 134,874,150	S885G	probably benign	Het
Evpl	T	A	11: 116,227,723	Q686L	probably damaging	Het
Fmo6	C	T	1: 162,920,563	A311T	probably damaging	Het
Gli1	A	T	10: 127,332,577	M469K	probably damaging	Het
Grin2c	G	A	11: 115,250,646	P882L	probably damaging	Het
H2-Ob	C	T	17: 34,242,614	T109I	probably damaging	Het
Jpt2	C	A	17: 24,948,673	A101S	probably benign	Het
Krt2	A	G	15: 101,816,497	V226A	probably damaging	Het
Lamc1	C	A	1: 153,234,580	Q1116H	possibly damaging	Het
Lamc1	T	G	1: 153,234,595	Q1111H	probably damaging	Het
Lamc1	T	C	1: 153,234,612	S1106G	probably benign	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp1	A	T	10: 127,575,286	D1399E	probably benign	Het
Ltbp4	G	T	7: 27,325,060	P715Q	probably damaging	Het
Mtor	T	C	4: 148,462,910	V450A	probably benign	Het
Myom1	A	T	17: 71,121,136	I1450F	probably damaging	Het
Naip6	A	G	13: 100,283,766	I1332T	possibly damaging	Het
Ncstn	A	G	1: 172,071,505	V353A	possibly damaging	Het
Nt5c3	T	C	6: 56,886,749	T149A	probably benign	Het
Olfr203	A	T	16: 59,303,989	I280F	probably damaging	Het
Olfr510	A	G	7: 108,668,157	H247R	probably damaging	Het
Paip1	T	C	13: 119,430,318	S54P	possibly damaging	Het
Prdm14	G	T	1: 13,125,744	A31E	probably benign	Het
Prr14l	A	G	5: 32,828,423	S1243P	probably damaging	Het
Prss1	T	C	6: 41,458,944	M1T	probably null	Het
Raver2	T	A	4: 101,102,950	V209D	probably damaging	Het
Scube1	T	A	15: 83,628,076		probably null	Het
Serpina3c	T	A	12: 104,151,546	I178F	probably damaging	Het
Slc16a13	A	T	11: 70,220,631	V16E	probably damaging	Het
Slc30a6	T	C	17: 74,415,645	S236P	possibly damaging	Het
Sobp	A	C	10: 43,022,693	S299A	probably damaging	Het
Sorcs3	C	A	19: 48,706,009	T574K	possibly damaging	Het
Trak2	A	T	1: 58,903,661	M862K	probably benign	Het
Ubox5	A	T	2: 130,600,710	V19E	probably damaging	Het
Vmn1r173	A	G	7: 23,702,735	T132A	probably benign	Het
Zfp820	T	C	17: 21,819,528	D273G	probably benign	Het

Other mutations in Muc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL00466:Muc6	APN	7	141645902	missense	possibly damaging	0.94
IGL00990:Muc6	APN	7	141638890	missense	possibly damaging	0.85
IGL01013:Muc6	APN	7	141648066	nonsense	probably null
IGL01021:Muc6	APN	7	141637162	missense	possibly damaging	0.53
IGL01061:Muc6	APN	7	141648454	missense	probably damaging	1.00
IGL01294:Muc6	APN	7	141646659	missense	probably damaging	1.00
IGL01449:Muc6	APN	7	141638614	missense	possibly damaging	0.92
IGL01474:Muc6	APN	7	141651307	missense	probably damaging	1.00
IGL01539:Muc6	APN	7	141650041	missense	probably benign	0.07
IGL01541:Muc6	APN	7	141649804	nonsense	probably null
IGL01810:Muc6	APN	7	141651062	missense	probably damaging	0.97
IGL01941:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL01954:Muc6	APN	7	141638584	missense	probably benign	0.06
IGL02096:Muc6	APN	7	141639850	intron	probably benign
IGL02192:Muc6	APN	7	141637804	missense	possibly damaging	0.91
IGL02217:Muc6	APN	7	141649624	missense	probably damaging	1.00
IGL02234:Muc6	APN	7	141640575	missense	probably benign	0.09
IGL02302:Muc6	APN	7	141641496	missense	possibly damaging	0.53
IGL02331:Muc6	APN	7	141640459	missense	possibly damaging	0.53
IGL02531:Muc6	APN	7	141636940	missense	possibly damaging	0.53
IGL02639:Muc6	APN	7	141649578	splice site	probably benign
IGL02851:Muc6	APN	7	141648361	missense	probably damaging	1.00
IGL03026:Muc6	APN	7	141640147	intron	probably benign
IGL03070:Muc6	APN	7	141644567	splice site	probably benign
IGL03108:Muc6	APN	7	141637489	missense	possibly damaging	0.93
IGL03350:Muc6	APN	7	141652059	missense	probably damaging	1.00
IGL03366:Muc6	APN	7	141648082	missense	probably damaging	1.00
anticipation	UTSW	7	141634450	frame shift	probably null
F5770:Muc6	UTSW	7	141647613	missense	probably benign	0.11
IGL03147:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0001:Muc6	UTSW	7	141641574	missense	possibly damaging	0.53
R0005:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R0147:Muc6	UTSW	7	141651990	missense	probably damaging	1.00
R0153:Muc6	UTSW	7	141634116	missense	possibly damaging	0.68
R0227:Muc6	UTSW	7	141639559	intron	probably benign
R0234:Muc6	UTSW	7	141649674	missense	possibly damaging	0.95
R0234:Muc6	UTSW	7	141649674	missense	possibly damaging	0.95
R0304:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0379:Muc6	UTSW	7	141636955	missense	possibly damaging	0.53
R0385:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R0423:Muc6	UTSW	7	141652283	missense	probably benign	0.01
R0499:Muc6	UTSW	7	141640468	missense	probably benign
R0503:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R0757:Muc6	UTSW	7	141638584	missense	probably benign	0.06
R0880:Muc6	UTSW	7	141637357	missense	possibly damaging	0.91
R1136:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R1170:Muc6	UTSW	7	141644233	missense	probably damaging	0.99
R1174:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R1175:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R1189:Muc6	UTSW	7	141645855	missense	probably damaging	1.00
R1259:Muc6	UTSW	7	141640197	intron	probably benign
R1293:Muc6	UTSW	7	141651990	missense	probably damaging	1.00
R1295:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1296:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1471:Muc6	UTSW	7	141647909	missense	possibly damaging	0.61
R1472:Muc6	UTSW	7	141651879	missense	probably benign	0.04
R1548:Muc6	UTSW	7	141652103	splice site	probably benign
R1548:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R1576:Muc6	UTSW	7	141634524	missense	possibly damaging	0.92
R1689:Muc6	UTSW	7	141647998	missense	probably damaging	1.00
R1702:Muc6	UTSW	7	141650487	missense	probably damaging	1.00
R1792:Muc6	UTSW	7	141634458	missense	probably benign	0.41
R1924:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R1938:Muc6	UTSW	7	141637098	missense	probably damaging	0.99
R1964:Muc6	UTSW	7	141640062	nonsense	probably null
R1964:Muc6	UTSW	7	141640063	intron	probably benign
R1975:Muc6	UTSW	7	141648101	missense	probably damaging	1.00
R2031:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2104:Muc6	UTSW	7	141634078	missense	probably benign	0.23
R2201:Muc6	UTSW	7	141649810	missense	probably damaging	1.00
R2218:Muc6	UTSW	7	141646960	missense	probably benign	0.41
R2245:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2261:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R2271:Muc6	UTSW	7	141637510	missense	possibly damaging	0.53
R2272:Muc6	UTSW	7	141637510	missense	possibly damaging	0.53
R2284:Muc6	UTSW	7	141637924	missense	possibly damaging	0.53
R2310:Muc6	UTSW	7	141637531	missense	possibly damaging	0.53
R2566:Muc6	UTSW	7	141640384	missense	possibly damaging	0.73
R2975:Muc6	UTSW	7	141637038	missense	possibly damaging	0.86
R3406:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3423:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3548:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R3693:Muc6	UTSW	7	141648681	splice site	probably benign
R3872:Muc6	UTSW	7	141640600	missense	probably benign
R4029:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4084:Muc6	UTSW	7	141648655	missense	probably damaging	1.00
R4126:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4410:Muc6	UTSW	7	141637663	missense	possibly damaging	0.91
R4508:Muc6	UTSW	7	141640089	intron	probably benign
R4509:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R4518:Muc6	UTSW	7	141644222	missense	probably benign	0.03
R4594:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R4677:Muc6	UTSW	7	141639790	intron	probably benign
R4678:Muc6	UTSW	7	141644287	missense	probably benign	0.09
R4737:Muc6	UTSW	7	141640159	intron	probably benign
R4737:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R4981:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
R5008:Muc6	UTSW	7	141639559	intron	probably benign
R5012:Muc6	UTSW	7	141636657	missense	possibly damaging	0.96
R5017:Muc6	UTSW	7	141640528	missense	probably benign
R5027:Muc6	UTSW	7	141636436	missense	probably benign	0.01
R5058:Muc6	UTSW	7	141644224	missense	probably benign	0.01
R5069:Muc6	UTSW	7	141651299	missense	probably damaging	1.00
R5126:Muc6	UTSW	7	141651299	missense	probably damaging	1.00
R5168:Muc6	UTSW	7	141639559	intron	probably benign
R5179:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R5198:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R5262:Muc6	UTSW	7	141651110	missense	possibly damaging	0.78
R5381:Muc6	UTSW	7	141637923	missense	possibly damaging	0.86
R5454:Muc6	UTSW	7	141648813	missense	possibly damaging	0.61
R5467:Muc6	UTSW	7	141636535	missense	possibly damaging	0.53
R5540:Muc6	UTSW	7	141649585	critical splice donor site	probably null
R5800:Muc6	UTSW	7	141640423	splice site	probably benign
R5808:Muc6	UTSW	7	141640093	intron	probably benign
R5865:Muc6	UTSW	7	141650504	missense	probably damaging	0.97
R5919:Muc6	UTSW	7	141641570	missense	possibly damaging	0.56
R6024:Muc6	UTSW	7	141641574	missense	possibly damaging	0.53
R6064:Muc6	UTSW	7	141648374	missense	probably damaging	1.00
R6126:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R6229:Muc6	UTSW	7	141640525	missense	probably benign
R6236:Muc6	UTSW	7	141638772	missense	possibly damaging	0.72
R6245:Muc6	UTSW	7	141648821	missense	probably damaging	1.00
R6254:Muc6	UTSW	7	141651115	missense	probably benign	0.09
R6418:Muc6	UTSW	7	141639610	intron	probably benign
R6609:Muc6	UTSW	7	141640433	splice site	probably benign
R6610:Muc6	UTSW	7	141640433	splice site	probably benign
R6611:Muc6	UTSW	7	141640433	splice site	probably benign
R6623:Muc6	UTSW	7	141639559	intron	probably benign
R6626:Muc6	UTSW	7	141639559	intron	probably benign
R6817:Muc6	UTSW	7	141651061	missense	probably damaging	0.99
R6923:Muc6	UTSW	7	141637540	missense	possibly damaging	0.91
R6989:Muc6	UTSW	7	141639979	intron	probably benign
R7001:Muc6	UTSW	7	141637407	missense	probably damaging	0.99
R7046:Muc6	UTSW	7	141640189	intron	probably benign
R7097:Muc6	UTSW	7	141634450	frame shift	probably null
R7099:Muc6	UTSW	7	141634450	frame shift	probably null
R7101:Muc6	UTSW	7	141634450	frame shift	probably null
R7107:Muc6	UTSW	7	141634450	frame shift	probably null
R7108:Muc6	UTSW	7	141634450	frame shift	probably null
R7112:Muc6	UTSW	7	141649277	missense	probably damaging	1.00
R7202:Muc6	UTSW	7	141634450	frame shift	probably null
R7204:Muc6	UTSW	7	141634450	frame shift	probably null
R7205:Muc6	UTSW	7	141634450	frame shift	probably null
R7222:Muc6	UTSW	7	141634515	missense	unknown
R7230:Muc6	UTSW	7	141649214	missense	probably damaging	1.00
R7278:Muc6	UTSW	7	141640575	missense	probably benign	0.09
R7483:Muc6	UTSW	7	141639823	missense	unknown
R7501:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7601:Muc6	UTSW	7	141636541	missense	unknown
R7641:Muc6	UTSW	7	141639825	missense	unknown
R7644:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7645:Muc6	UTSW	7	141648658	missense	probably benign	0.40
R7659:Muc6	UTSW	7	141637060	missense	possibly damaging	0.53
R7674:Muc6	UTSW	7	141639825	missense	unknown
R7679:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7680:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7689:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7690:Muc6	UTSW	7	141637746	missense	probably damaging	0.98
R7760:Muc6	UTSW	7	141651057	splice site	probably null
R7806:Muc6	UTSW	7	141637474	missense	possibly damaging	0.53
R7809:Muc6	UTSW	7	141640371	missense	probably benign	0.02
R7848:Muc6	UTSW	7	141645921	missense	possibly damaging	0.53
R7859:Muc6	UTSW	7	141645420	missense	probably damaging	0.96
R8054:Muc6	UTSW	7	141645481	missense	probably damaging	1.00
R8085:Muc6	UTSW	7	141640462	missense	unknown
R8130:Muc6	UTSW	7	141647087	missense	probably damaging	0.97
R8210:Muc6	UTSW	7	141649408	critical splice donor site	probably null
R8273:Muc6	UTSW	7	141640528	missense	unknown
R8294:Muc6	UTSW	7	141637350	missense	possibly damaging	0.96
R8329:Muc6	UTSW	7	141640258	missense	unknown
R8379:Muc6	UTSW	7	141644312	nonsense	probably null
R8537:Muc6	UTSW	7	141647917	missense	probably benign	0.03
R8736:Muc6	UTSW	7	141642172	missense	possibly damaging	0.53
R8767:Muc6	UTSW	7	141643282	missense	probably damaging	1.00
R8902:Muc6	UTSW	7	141647524	missense	possibly damaging	0.93
R9009:Muc6	UTSW	7	141637105	missense	possibly damaging	0.73
R9010:Muc6	UTSW	7	141640084	missense	unknown
R9023:Muc6	UTSW	7	141651167	nonsense	probably null
R9058:Muc6	UTSW	7	141638241	missense	possibly damaging	0.61
R9257:Muc6	UTSW	7	141640471	missense	unknown
R9495:Muc6	UTSW	7	141651133	missense	probably damaging	0.98
R9563:Muc6	UTSW	7	141637870	missense	possibly damaging	0.53
R9645:Muc6	UTSW	7	141637870	missense	possibly damaging	0.53
R9659:Muc6	UTSW	7	141645833	missense	probably damaging	1.00
R9733:Muc6	UTSW	7	141636397	missense	unknown
R9787:Muc6	UTSW	7	141641481	nonsense	probably null
R9788:Muc6	UTSW	7	141645833	missense	probably damaging	1.00
V7581:Muc6	UTSW	7	141647613	missense	probably benign	0.11
V7583:Muc6	UTSW	7	141647613	missense	probably benign	0.11
X0026:Muc6	UTSW	7	141651699	missense	possibly damaging	0.94
X0058:Muc6	UTSW	7	141638400	missense	possibly damaging	0.95
Z1177:Muc6	UTSW	7	141637914	missense	possibly damaging	0.72
Z1177:Muc6	UTSW	7	141650436	missense	probably benign	0.29
Z1177:Muc6	UTSW	7	141651391	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- TAAGTCCCTCAGTGGTTGGTGTCACAG -3'
(R):5'- CAAAACATACCACAGGTGTCTCCTTGG -3'

Sequencing Primer
(F):5'- GTGTACTGTCCCAGACACAGC -3'
(R):5'- AGGTGTCTCCTTGGAAACATCTG -3'

Posted On

2013-11-08