Mutagenetix > Incidental Mutations

Incidental Mutation 'R0792:Ap3d1'

82463

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

038972-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.939) question?

Stock #

R0792 (G1)

Quality Score

189

Status

Not validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80708479 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1161 (H1161Q)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218184] [ENSMUST00000218610]

Predicted Effect

probably benign
Transcript: ENSMUST00000020420
AA Change: H1161Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: H1161Q

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000095426

SMART Domains

Protein: ENSMUSP00000093076
Gene: ENSMUSG00000055862

Domain	Start	End	E-Value	Type
Pfam:IZUMO	26	167	1.1e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217823

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218058

Predicted Effect

probably benign
Transcript: ENSMUST00000218184

Predicted Effect

probably benign
Transcript: ENSMUST00000218330

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218538

Predicted Effect

probably benign
Transcript: ENSMUST00000218610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219422

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219746

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219816

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219987

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219986

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.6%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	T	19: 45,933,868		probably null	Het
Acsl5	T	C	19: 55,280,492	V195A	probably benign	Het
Adgrb1	A	G	15: 74,580,617	M211V	probably damaging	Het
Ahnak	G	T	19: 9,016,734	M5127I	probably benign	Het
Akr1c13	T	C	13: 4,194,112	Y55H	probably damaging	Het
Atp2b2	C	T	6: 113,773,388	R625H	probably damaging	Het
Bdnf	G	A	2: 109,724,118	C239Y	probably damaging	Het
Bpifa5	G	T	2: 154,165,619		probably null	Het
C9	T	A	15: 6,486,762	F349I	probably damaging	Het
Ccdc180	T	C	4: 45,927,975	V1170A	possibly damaging	Het
Celsr1	A	G	15: 85,931,276	V1846A	probably benign	Het
Cep68	A	T	11: 20,240,652	L120H	possibly damaging	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Cpne1	G	T	2: 156,077,419	Q343K	probably benign	Het
D3Ertd254e	A	G	3: 36,164,562	M244V	probably benign	Het
Dlc1	A	T	8: 36,938,548	I29K	probably benign	Het
Dnah9	T	C	11: 65,896,001	D3602G	possibly damaging	Het
Dock1	A	G	7: 134,874,150	S885G	probably benign	Het
Evpl	T	A	11: 116,227,723	Q686L	probably damaging	Het
Fmo6	C	T	1: 162,920,563	A311T	probably damaging	Het
Gli1	A	T	10: 127,332,577	M469K	probably damaging	Het
Grin2c	G	A	11: 115,250,646	P882L	probably damaging	Het
H2-Ob	C	T	17: 34,242,614	T109I	probably damaging	Het
Jpt2	C	A	17: 24,948,673	A101S	probably benign	Het
Krt2	A	G	15: 101,816,497	V226A	probably damaging	Het
Lamc1	C	A	1: 153,234,580	Q1116H	possibly damaging	Het
Lamc1	T	G	1: 153,234,595	Q1111H	probably damaging	Het
Lamc1	T	C	1: 153,234,612	S1106G	probably benign	Het
Lrp1	A	T	10: 127,575,286	D1399E	probably benign	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Ltbp4	G	T	7: 27,325,060	P715Q	probably damaging	Het
Mtor	T	C	4: 148,462,910	V450A	probably benign	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Myom1	A	T	17: 71,121,136	I1450F	probably damaging	Het
Naip6	A	G	13: 100,283,766	I1332T	possibly damaging	Het
Ncstn	A	G	1: 172,071,505	V353A	possibly damaging	Het
Nt5c3	T	C	6: 56,886,749	T149A	probably benign	Het
Olfr203	A	T	16: 59,303,989	I280F	probably damaging	Het
Olfr510	A	G	7: 108,668,157	H247R	probably damaging	Het
Paip1	T	C	13: 119,430,318	S54P	possibly damaging	Het
Prdm14	G	T	1: 13,125,744	A31E	probably benign	Het
Prr14l	A	G	5: 32,828,423	S1243P	probably damaging	Het
Prss1	T	C	6: 41,458,944	M1T	probably null	Het
Raver2	T	A	4: 101,102,950	V209D	probably damaging	Het
Scube1	T	A	15: 83,628,076		probably null	Het
Serpina3c	T	A	12: 104,151,546	I178F	probably damaging	Het
Slc16a13	A	T	11: 70,220,631	V16E	probably damaging	Het
Slc30a6	T	C	17: 74,415,645	S236P	possibly damaging	Het
Sobp	A	C	10: 43,022,693	S299A	probably damaging	Het
Sorcs3	C	A	19: 48,706,009	T574K	possibly damaging	Het
Trak2	A	T	1: 58,903,661	M862K	probably benign	Het
Ubox5	A	T	2: 130,600,710	V19E	probably damaging	Het
Vmn1r173	A	G	7: 23,702,735	T132A	probably benign	Het
Zfp820	T	C	17: 21,819,528	D273G	probably benign	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TGCCTTGTGTTCCCAAACCAGATG -3'
(R):5'- GCAAAGTTGCTAGAGTCAGGAGACC -3'

Sequencing Primer
(F):5'- TACAGCTCAGCTAGGAGGTC -3'
(R):5'- ACAGTGATAACACTCTTGGTGGC -3'

Posted On

2013-11-08