Incidental Mutation 'R0792:Dnah9'
ID 82468
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Name dynein, axonemal, heavy chain 9
Synonyms D11Ertd686e, Dnahc9
MMRRC Submission 038972-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.403) question?
Stock # R0792 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 65722150-66059379 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65786827 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3602 (D3602G)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000080665
AA Change: D3602G

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: D3602G

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152386
AA Change: D1151G
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: D1151G

DomainStartEndE-ValueType
Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,268,924 (GRCm39) V195A probably benign Het
Adgrb1 A G 15: 74,452,466 (GRCm39) M211V probably damaging Het
Ahnak G T 19: 8,994,098 (GRCm39) M5127I probably benign Het
Akr1c13 T C 13: 4,244,111 (GRCm39) Y55H probably damaging Het
Ap3d1 A T 10: 80,544,313 (GRCm39) H1161Q probably benign Het
Armh3 A T 19: 45,922,307 (GRCm39) probably null Het
Atp2b2 C T 6: 113,750,349 (GRCm39) R625H probably damaging Het
Bdnf G A 2: 109,554,463 (GRCm39) C239Y probably damaging Het
Bpifa5 G T 2: 154,007,539 (GRCm39) probably null Het
C9 T A 15: 6,516,243 (GRCm39) F349I probably damaging Het
Ccdc180 T C 4: 45,927,975 (GRCm39) V1170A possibly damaging Het
Celsr1 A G 15: 85,815,477 (GRCm39) V1846A probably benign Het
Cep68 A T 11: 20,190,652 (GRCm39) L120H possibly damaging Het
Cntrl T A 2: 35,045,291 (GRCm39) I781K possibly damaging Het
Cpne1 G T 2: 155,919,339 (GRCm39) Q343K probably benign Het
Dlc1 A T 8: 37,405,702 (GRCm39) I29K probably benign Het
Dock1 A G 7: 134,475,879 (GRCm39) S885G probably benign Het
Evpl T A 11: 116,118,549 (GRCm39) Q686L probably damaging Het
Fmo6 C T 1: 162,748,132 (GRCm39) A311T probably damaging Het
Gli1 A T 10: 127,168,446 (GRCm39) M469K probably damaging Het
Grin2c G A 11: 115,141,472 (GRCm39) P882L probably damaging Het
H2-Ob C T 17: 34,461,588 (GRCm39) T109I probably damaging Het
Jpt2 C A 17: 25,167,647 (GRCm39) A101S probably benign Het
Krt1c A G 15: 101,724,932 (GRCm39) V226A probably damaging Het
Lamc1 T G 1: 153,110,341 (GRCm39) Q1111H probably damaging Het
Lamc1 T C 1: 153,110,358 (GRCm39) S1106G probably benign Het
Lamc1 C A 1: 153,110,326 (GRCm39) Q1116H possibly damaging Het
Lrp1 G T 10: 127,403,233 (GRCm39) D2113E probably damaging Het
Lrp1 A T 10: 127,411,155 (GRCm39) D1399E probably benign Het
Ltbp4 G T 7: 27,024,485 (GRCm39) P715Q probably damaging Het
Mtor T C 4: 148,547,367 (GRCm39) V450A probably benign Het
Muc6 G A 7: 141,223,981 (GRCm39) probably benign Het
Myom1 A T 17: 71,428,131 (GRCm39) I1450F probably damaging Het
Naip6 A G 13: 100,420,274 (GRCm39) I1332T possibly damaging Het
Ncstn A G 1: 171,899,072 (GRCm39) V353A possibly damaging Het
Nt5c3 T C 6: 56,863,734 (GRCm39) T149A probably benign Het
Or5ac21 A T 16: 59,124,352 (GRCm39) I280F probably damaging Het
Or5p81 A G 7: 108,267,364 (GRCm39) H247R probably damaging Het
Paip1 T C 13: 119,566,854 (GRCm39) S54P possibly damaging Het
Prdm14 G T 1: 13,195,968 (GRCm39) A31E probably benign Het
Prr14l A G 5: 32,985,767 (GRCm39) S1243P probably damaging Het
Prss1 T C 6: 41,435,878 (GRCm39) M1T probably null Het
Raver2 T A 4: 100,960,147 (GRCm39) V209D probably damaging Het
Scube1 T A 15: 83,512,277 (GRCm39) probably null Het
Serpina3c T A 12: 104,117,805 (GRCm39) I178F probably damaging Het
Slc16a13 A T 11: 70,111,457 (GRCm39) V16E probably damaging Het
Slc30a6 T C 17: 74,722,640 (GRCm39) S236P possibly damaging Het
Sobp A C 10: 42,898,689 (GRCm39) S299A probably damaging Het
Sorcs3 C A 19: 48,694,448 (GRCm39) T574K possibly damaging Het
Trak2 A T 1: 58,942,820 (GRCm39) M862K probably benign Het
Ubox5 A T 2: 130,442,630 (GRCm39) V19E probably damaging Het
Vmn1r173 A G 7: 23,402,160 (GRCm39) T132A probably benign Het
Zfp267 A G 3: 36,218,711 (GRCm39) M244V probably benign Het
Zfp820 T C 17: 22,038,509 (GRCm39) D273G probably benign Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65,732,064 (GRCm39) splice site probably benign
IGL00805:Dnah9 APN 11 65,772,521 (GRCm39) missense probably benign 0.00
IGL00826:Dnah9 APN 11 65,880,768 (GRCm39) missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65,740,806 (GRCm39) missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 65,962,882 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah9 APN 11 65,971,397 (GRCm39) missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66,046,285 (GRCm39) missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65,846,543 (GRCm39) missense probably benign 0.14
IGL01537:Dnah9 APN 11 65,838,506 (GRCm39) missense probably benign
IGL01565:Dnah9 APN 11 65,924,655 (GRCm39) missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66,009,656 (GRCm39) missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65,722,441 (GRCm39) nonsense probably null
IGL01625:Dnah9 APN 11 65,935,471 (GRCm39) missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66,009,655 (GRCm39) missense probably damaging 1.00
IGL01819:Dnah9 APN 11 65,998,952 (GRCm39) missense probably benign 0.33
IGL01896:Dnah9 APN 11 66,021,492 (GRCm39) missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 65,965,860 (GRCm39) splice site probably benign
IGL01923:Dnah9 APN 11 66,016,061 (GRCm39) splice site probably benign
IGL02059:Dnah9 APN 11 65,963,784 (GRCm39) missense probably damaging 1.00
IGL02068:Dnah9 APN 11 65,951,871 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66,008,318 (GRCm39) missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65,818,526 (GRCm39) missense probably damaging 1.00
IGL02264:Dnah9 APN 11 65,971,314 (GRCm39) splice site probably benign
IGL02325:Dnah9 APN 11 65,725,043 (GRCm39) missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66,015,979 (GRCm39) missense probably benign
IGL02440:Dnah9 APN 11 65,846,072 (GRCm39) missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65,838,444 (GRCm39) nonsense probably null
IGL02496:Dnah9 APN 11 65,920,189 (GRCm39) missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65,818,427 (GRCm39) missense probably benign 0.02
IGL02718:Dnah9 APN 11 65,777,466 (GRCm39) missense probably damaging 0.99
IGL02832:Dnah9 APN 11 65,931,172 (GRCm39) missense probably damaging 1.00
IGL02851:Dnah9 APN 11 65,928,570 (GRCm39) splice site probably benign
IGL02859:Dnah9 APN 11 65,772,445 (GRCm39) splice site probably benign
IGL02864:Dnah9 APN 11 65,951,829 (GRCm39) missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66,009,793 (GRCm39) missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65,732,099 (GRCm39) missense probably benign 0.23
IGL02987:Dnah9 APN 11 65,746,098 (GRCm39) missense probably damaging 0.98
IGL03160:Dnah9 APN 11 65,998,880 (GRCm39) missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65,872,067 (GRCm39) missense probably benign 0.13
IGL03180:Dnah9 APN 11 65,777,465 (GRCm39) missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65,838,368 (GRCm39) missense probably damaging 1.00
anarchy UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
sacco UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
Tweed UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
vanzetti UTSW 11 65,746,198 (GRCm39) nonsense probably null
IGL02837:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 65,895,839 (GRCm39) missense probably benign 0.44
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0070:Dnah9 UTSW 11 66,050,866 (GRCm39) missense probably benign 0.10
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0180:Dnah9 UTSW 11 66,038,116 (GRCm39) missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R0230:Dnah9 UTSW 11 65,746,141 (GRCm39) missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65,802,678 (GRCm39) missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65,802,615 (GRCm39) critical splice donor site probably null
R0288:Dnah9 UTSW 11 65,915,960 (GRCm39) critical splice donor site probably null
R0309:Dnah9 UTSW 11 65,917,798 (GRCm39) splice site probably benign
R0356:Dnah9 UTSW 11 66,021,388 (GRCm39) critical splice donor site probably null
R0403:Dnah9 UTSW 11 65,975,615 (GRCm39) missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 65,998,961 (GRCm39) missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65,809,539 (GRCm39) splice site probably benign
R0496:Dnah9 UTSW 11 65,965,961 (GRCm39) missense probably null 1.00
R0557:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65,881,315 (GRCm39) missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66,009,703 (GRCm39) missense probably benign 0.02
R0599:Dnah9 UTSW 11 65,856,515 (GRCm39) missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65,732,159 (GRCm39) missense probably damaging 1.00
R0666:Dnah9 UTSW 11 65,976,284 (GRCm39) missense probably benign 0.01
R0715:Dnah9 UTSW 11 65,972,074 (GRCm39) splice site probably benign
R0726:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R0737:Dnah9 UTSW 11 65,998,724 (GRCm39) missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66,046,356 (GRCm39) missense probably benign 0.30
R0829:Dnah9 UTSW 11 65,896,002 (GRCm39) missense probably benign 0.00
R0973:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R0974:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R1055:Dnah9 UTSW 11 66,050,837 (GRCm39) missense probably damaging 1.00
R1081:Dnah9 UTSW 11 65,975,703 (GRCm39) missense probably damaging 0.99
R1184:Dnah9 UTSW 11 65,975,438 (GRCm39) critical splice donor site probably null
R1225:Dnah9 UTSW 11 65,761,886 (GRCm39) missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65,818,414 (GRCm39) missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65,846,573 (GRCm39) missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65,764,958 (GRCm39) missense probably benign 0.22
R1447:Dnah9 UTSW 11 65,999,308 (GRCm39) missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65,818,612 (GRCm39) missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1486:Dnah9 UTSW 11 65,725,098 (GRCm39) missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65,772,587 (GRCm39) missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66,003,156 (GRCm39) missense probably benign
R1617:Dnah9 UTSW 11 65,786,747 (GRCm39) missense probably damaging 1.00
R1623:Dnah9 UTSW 11 65,928,463 (GRCm39) missense probably damaging 1.00
R1626:Dnah9 UTSW 11 65,976,093 (GRCm39) missense probably benign 0.05
R1671:Dnah9 UTSW 11 65,818,789 (GRCm39) missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65,845,650 (GRCm39) nonsense probably null
R1701:Dnah9 UTSW 11 65,802,750 (GRCm39) missense probably damaging 1.00
R1702:Dnah9 UTSW 11 65,976,021 (GRCm39) missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65,805,980 (GRCm39) missense probably benign 0.11
R1718:Dnah9 UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65,872,048 (GRCm39) missense probably benign 0.31
R1784:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66,010,420 (GRCm39) critical splice donor site probably null
R1801:Dnah9 UTSW 11 65,846,123 (GRCm39) missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65,740,887 (GRCm39) missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66,009,667 (GRCm39) missense probably benign 0.10
R1840:Dnah9 UTSW 11 65,725,024 (GRCm39) nonsense probably null
R1847:Dnah9 UTSW 11 65,725,212 (GRCm39) missense probably damaging 1.00
R1872:Dnah9 UTSW 11 65,928,316 (GRCm39) missense probably benign 0.16
R1929:Dnah9 UTSW 11 65,867,224 (GRCm39) missense probably benign 0.05
R1969:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65,846,164 (GRCm39) missense probably benign 0.11
R2049:Dnah9 UTSW 11 65,935,509 (GRCm39) missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66,036,261 (GRCm39) missense probably benign 0.31
R2104:Dnah9 UTSW 11 65,951,950 (GRCm39) missense probably damaging 1.00
R2109:Dnah9 UTSW 11 65,928,411 (GRCm39) missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66,008,309 (GRCm39) missense probably damaging 1.00
R2172:Dnah9 UTSW 11 65,963,605 (GRCm39) missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65,750,325 (GRCm39) missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2272:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2396:Dnah9 UTSW 11 65,975,984 (GRCm39) missense probably benign 0.01
R2398:Dnah9 UTSW 11 65,806,029 (GRCm39) missense probably damaging 1.00
R2418:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2419:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2510:Dnah9 UTSW 11 65,895,995 (GRCm39) missense probably damaging 1.00
R2680:Dnah9 UTSW 11 65,924,751 (GRCm39) missense probably benign 0.00
R2875:Dnah9 UTSW 11 66,059,287 (GRCm39) missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66,008,414 (GRCm39) missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3237:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3433:Dnah9 UTSW 11 65,965,938 (GRCm39) missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66,047,734 (GRCm39) nonsense probably null
R3820:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3821:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3822:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3861:Dnah9 UTSW 11 65,943,820 (GRCm39) splice site probably benign
R3918:Dnah9 UTSW 11 65,761,800 (GRCm39) missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65,725,290 (GRCm39) missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66,024,461 (GRCm39) missense probably benign 0.03
R4072:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4076:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4097:Dnah9 UTSW 11 65,881,285 (GRCm39) missense probably damaging 1.00
R4409:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65,872,040 (GRCm39) missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66,009,575 (GRCm39) missense probably benign 0.00
R4434:Dnah9 UTSW 11 65,998,901 (GRCm39) missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65,772,467 (GRCm39) missense probably benign 0.07
R4452:Dnah9 UTSW 11 65,917,908 (GRCm39) missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66,038,215 (GRCm39) missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4590:Dnah9 UTSW 11 65,931,218 (GRCm39) missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66,058,978 (GRCm39) missense probably benign
R4655:Dnah9 UTSW 11 65,846,558 (GRCm39) missense probably benign 0.00
R4667:Dnah9 UTSW 11 66,046,357 (GRCm39) missense probably benign
R4718:Dnah9 UTSW 11 65,976,299 (GRCm39) missense probably benign
R4720:Dnah9 UTSW 11 65,967,184 (GRCm39) missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65,818,552 (GRCm39) missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65,764,950 (GRCm39) nonsense probably null
R4963:Dnah9 UTSW 11 65,975,437 (GRCm39) splice site probably null
R5074:Dnah9 UTSW 11 65,740,866 (GRCm39) missense probably damaging 1.00
R5230:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66,003,159 (GRCm39) missense probably benign 0.34
R5364:Dnah9 UTSW 11 65,772,522 (GRCm39) missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 65,920,180 (GRCm39) missense probably damaging 1.00
R5386:Dnah9 UTSW 11 65,920,182 (GRCm39) missense probably damaging 1.00
R5389:Dnah9 UTSW 11 65,986,140 (GRCm39) nonsense probably null
R5541:Dnah9 UTSW 11 66,036,162 (GRCm39) missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65,772,566 (GRCm39) missense probably benign 0.00
R5576:Dnah9 UTSW 11 65,724,922 (GRCm39) splice site probably null
R5648:Dnah9 UTSW 11 65,818,581 (GRCm39) missense probably benign 0.00
R5653:Dnah9 UTSW 11 65,740,806 (GRCm39) missense probably damaging 0.99
R5713:Dnah9 UTSW 11 65,916,049 (GRCm39) missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65,846,065 (GRCm39) missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66,017,427 (GRCm39) missense probably benign 0.01
R5831:Dnah9 UTSW 11 65,998,947 (GRCm39) missense probably benign 0.00
R5847:Dnah9 UTSW 11 65,986,066 (GRCm39) frame shift probably null
R5870:Dnah9 UTSW 11 65,976,036 (GRCm39) missense probably benign 0.01
R5902:Dnah9 UTSW 11 65,916,013 (GRCm39) missense probably benign 0.08
R5918:Dnah9 UTSW 11 65,725,025 (GRCm39) missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65,725,307 (GRCm39) missense probably damaging 1.00
R6065:Dnah9 UTSW 11 66,036,223 (GRCm39) missense possibly damaging 0.65
R6065:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.05
R6086:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
R6086:Dnah9 UTSW 11 65,880,741 (GRCm39) missense probably damaging 0.99
R6102:Dnah9 UTSW 11 65,881,342 (GRCm39) missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66,038,225 (GRCm39) missense probably benign
R6154:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.00
R6262:Dnah9 UTSW 11 65,772,631 (GRCm39) splice site probably null
R6265:Dnah9 UTSW 11 66,058,920 (GRCm39) missense probably benign 0.04
R6290:Dnah9 UTSW 11 65,732,201 (GRCm39) missense probably damaging 1.00
R6345:Dnah9 UTSW 11 65,928,519 (GRCm39) missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66,059,107 (GRCm39) missense probably benign 0.37
R6582:Dnah9 UTSW 11 65,951,923 (GRCm39) missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65,846,192 (GRCm39) missense probably damaging 1.00
R6800:Dnah9 UTSW 11 65,963,565 (GRCm39) critical splice donor site probably null
R6812:Dnah9 UTSW 11 65,872,155 (GRCm39) missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66,008,452 (GRCm39) missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 65,975,975 (GRCm39) missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 65,967,167 (GRCm39) missense probably damaging 1.00
R6977:Dnah9 UTSW 11 65,998,735 (GRCm39) missense probably benign 0.37
R7021:Dnah9 UTSW 11 65,872,057 (GRCm39) missense probably benign
R7161:Dnah9 UTSW 11 65,746,198 (GRCm39) nonsense probably null
R7175:Dnah9 UTSW 11 66,024,463 (GRCm39) missense probably benign 0.03
R7199:Dnah9 UTSW 11 66,009,770 (GRCm39) missense probably benign 0.04
R7231:Dnah9 UTSW 11 65,856,473 (GRCm39) missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65,881,302 (GRCm39) missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65,880,677 (GRCm39) missense probably benign 0.00
R7350:Dnah9 UTSW 11 65,971,404 (GRCm39) missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66,008,233 (GRCm39) critical splice donor site probably null
R7427:Dnah9 UTSW 11 65,846,045 (GRCm39) missense probably benign
R7477:Dnah9 UTSW 11 65,883,557 (GRCm39) missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65,732,240 (GRCm39) missense probably benign 0.01
R7521:Dnah9 UTSW 11 65,880,663 (GRCm39) missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66,016,041 (GRCm39) missense probably benign 0.43
R7659:Dnah9 UTSW 11 65,880,606 (GRCm39) missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66,009,784 (GRCm39) missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65,802,656 (GRCm39) missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65,740,839 (GRCm39) missense probably damaging 1.00
R7808:Dnah9 UTSW 11 65,896,631 (GRCm39) nonsense probably null
R7814:Dnah9 UTSW 11 65,896,486 (GRCm39) missense probably damaging 1.00
R7818:Dnah9 UTSW 11 65,916,037 (GRCm39) missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65,732,227 (GRCm39) missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 65,908,201 (GRCm39) missense probably benign 0.02
R8232:Dnah9 UTSW 11 65,746,149 (GRCm39) missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65,880,644 (GRCm39) missense probably benign 0.00
R8326:Dnah9 UTSW 11 66,008,452 (GRCm39) missense probably benign 0.01
R8338:Dnah9 UTSW 11 65,732,067 (GRCm39) critical splice donor site probably null
R8356:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65,722,556 (GRCm39) missense probably benign 0.00
R8721:Dnah9 UTSW 11 65,986,124 (GRCm39) missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65,818,816 (GRCm39) missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65,796,057 (GRCm39) missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65,750,309 (GRCm39) missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65,740,742 (GRCm39) missense probably benign 0.13
R8837:Dnah9 UTSW 11 65,746,060 (GRCm39) missense possibly damaging 0.72
R8886:Dnah9 UTSW 11 65,943,840 (GRCm39) missense probably damaging 1.00
R8887:Dnah9 UTSW 11 65,746,210 (GRCm39) missense probably benign 0.01
R8921:Dnah9 UTSW 11 65,802,747 (GRCm39) missense probably benign
R8933:Dnah9 UTSW 11 65,746,078 (GRCm39) missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66,059,226 (GRCm39) missense possibly damaging 0.91
R8967:Dnah9 UTSW 11 66,015,938 (GRCm39) critical splice donor site probably null
R8979:Dnah9 UTSW 11 65,895,978 (GRCm39) missense probably benign
R8991:Dnah9 UTSW 11 65,777,506 (GRCm39) missense probably damaging 0.96
R9016:Dnah9 UTSW 11 65,998,856 (GRCm39) missense probably damaging 0.99
R9025:Dnah9 UTSW 11 65,896,651 (GRCm39) missense probably damaging 1.00
R9043:Dnah9 UTSW 11 65,845,680 (GRCm39) missense
R9047:Dnah9 UTSW 11 65,962,925 (GRCm39) missense possibly damaging 0.89
R9076:Dnah9 UTSW 11 66,008,464 (GRCm39) missense probably benign 0.21
R9113:Dnah9 UTSW 11 65,880,713 (GRCm39) missense probably damaging 1.00
R9152:Dnah9 UTSW 11 66,021,457 (GRCm39) missense probably damaging 1.00
R9187:Dnah9 UTSW 11 65,895,972 (GRCm39) missense probably benign
R9198:Dnah9 UTSW 11 65,846,570 (GRCm39) missense probably benign 0.02
R9203:Dnah9 UTSW 11 65,746,113 (GRCm39) missense possibly damaging 0.58
R9234:Dnah9 UTSW 11 65,924,751 (GRCm39) missense possibly damaging 0.68
R9245:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R9265:Dnah9 UTSW 11 65,732,081 (GRCm39) missense probably benign 0.01
R9307:Dnah9 UTSW 11 65,976,300 (GRCm39) missense probably benign 0.14
R9336:Dnah9 UTSW 11 65,761,775 (GRCm39) missense probably damaging 1.00
R9386:Dnah9 UTSW 11 65,838,368 (GRCm39) missense probably damaging 1.00
R9498:Dnah9 UTSW 11 65,739,199 (GRCm39) missense probably damaging 0.99
R9508:Dnah9 UTSW 11 65,725,089 (GRCm39) missense probably damaging 1.00
R9524:Dnah9 UTSW 11 65,976,309 (GRCm39) missense possibly damaging 0.92
R9577:Dnah9 UTSW 11 65,867,347 (GRCm39) missense probably benign 0.00
R9583:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R9587:Dnah9 UTSW 11 65,999,217 (GRCm39) missense probably null 0.92
R9612:Dnah9 UTSW 11 65,818,475 (GRCm39) missense probably benign 0.00
R9748:Dnah9 UTSW 11 65,976,290 (GRCm39) missense possibly damaging 0.51
R9749:Dnah9 UTSW 11 65,986,202 (GRCm39) missense probably damaging 1.00
R9759:Dnah9 UTSW 11 65,965,944 (GRCm39) missense probably null 0.93
R9784:Dnah9 UTSW 11 65,975,960 (GRCm39) missense probably damaging 0.99
V3553:Dnah9 UTSW 11 65,860,902 (GRCm39) missense probably damaging 1.00
X0027:Dnah9 UTSW 11 65,976,305 (GRCm39) missense probably benign 0.07
X0028:Dnah9 UTSW 11 65,881,278 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,860,910 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,818,679 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,786,798 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,963,661 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,928,300 (GRCm39) missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66,017,476 (GRCm39) missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1186:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AACGAAAGGAGCATCTGGCCTG -3'
(R):5'- TGACACGGAAAGAGCATAATCCAGC -3'

Sequencing Primer
(F):5'- CCTTTAGGCCCTCCAGAGC -3'
(R):5'- tcctggagcctctcagatac -3'
Posted On 2013-11-08