Mutagenetix > Incidental Mutation

Incidental Mutation 'R0792:Grin2c'

82470

Institutional Source

Beutler Lab

Gene Symbol

Grin2c

Ensembl Gene

ENSMUSG00000020734

Gene Name

glutamate receptor, ionotropic, NMDA2C (epsilon 3)

Synonyms

NR2C, GluRepsilon3, NMDAR2C

MMRRC Submission

038972-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.209) question?

Stock #

R0792 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115249169-115267243 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 115250646 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 882 (P882L)

Ref Sequence

ENSEMBL: ENSMUSP00000102164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000061450] [ENSMUST00000100235] [ENSMUST00000106554]

AlphaFold

Q01098

Predicted Effect

probably damaging
Transcript: ENSMUST00000003351
AA Change: P882L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734
AA Change: P882L

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	99	299	5.1e-12	PFAM
PBPe	440	796	1.11e-79	SMART
Lig_chan-Glu_bd	448	500	2.79e-18	SMART
transmembrane domain	816	835	N/A	INTRINSIC
Pfam:NMDAR2_C	837	924	6.8e-15	PFAM
low complexity region	941	975	N/A	INTRINSIC
low complexity region	1041	1058	N/A	INTRINSIC
low complexity region	1063	1076	N/A	INTRINSIC
low complexity region	1173	1182	N/A	INTRINSIC
low complexity region	1194	1203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000061450

SMART Domains

Protein: ENSMUSP00000056805
Gene: ENSMUSG00000045980

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	13	77	3.4e-10	PFAM
low complexity region	84	100	N/A	INTRINSIC
Pfam:Aa_trans	128	487	4.5e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100235

SMART Domains

Protein: ENSMUSP00000097807
Gene: ENSMUSG00000045980

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	13	81	5.5e-11	PFAM
low complexity region	84	100	N/A	INTRINSIC
Pfam:Aa_trans	127	485	1.2e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106554
AA Change: P882L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734
AA Change: P882L

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	100	306	6.9e-10	PFAM
PBPe	440	796	1.11e-79	SMART
Lig_chan-Glu_bd	448	500	2.79e-18	SMART
transmembrane domain	816	835	N/A	INTRINSIC
Pfam:NMDAR2_C	837	926	1.1e-13	PFAM
low complexity region	941	975	N/A	INTRINSIC
low complexity region	1041	1058	N/A	INTRINSIC
low complexity region	1063	1076	N/A	INTRINSIC
low complexity region	1173	1182	N/A	INTRINSIC
low complexity region	1194	1203	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158919

Meta Mutation Damage Score

0.1608

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.6%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	T	19: 45,933,868		probably null	Het
Acsl5	T	C	19: 55,280,492	V195A	probably benign	Het
Adgrb1	A	G	15: 74,580,617	M211V	probably damaging	Het
Ahnak	G	T	19: 9,016,734	M5127I	probably benign	Het
Akr1c13	T	C	13: 4,194,112	Y55H	probably damaging	Het
Ap3d1	A	T	10: 80,708,479	H1161Q	probably benign	Het
Atp2b2	C	T	6: 113,773,388	R625H	probably damaging	Het
Bdnf	G	A	2: 109,724,118	C239Y	probably damaging	Het
Bpifa5	G	T	2: 154,165,619		probably null	Het
C9	T	A	15: 6,486,762	F349I	probably damaging	Het
Ccdc180	T	C	4: 45,927,975	V1170A	possibly damaging	Het
Celsr1	A	G	15: 85,931,276	V1846A	probably benign	Het
Cep68	A	T	11: 20,240,652	L120H	possibly damaging	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Cpne1	G	T	2: 156,077,419	Q343K	probably benign	Het
D3Ertd254e	A	G	3: 36,164,562	M244V	probably benign	Het
Dlc1	A	T	8: 36,938,548	I29K	probably benign	Het
Dnah9	T	C	11: 65,896,001	D3602G	possibly damaging	Het
Dock1	A	G	7: 134,874,150	S885G	probably benign	Het
Evpl	T	A	11: 116,227,723	Q686L	probably damaging	Het
Fmo6	C	T	1: 162,920,563	A311T	probably damaging	Het
Gli1	A	T	10: 127,332,577	M469K	probably damaging	Het
H2-Ob	C	T	17: 34,242,614	T109I	probably damaging	Het
Jpt2	C	A	17: 24,948,673	A101S	probably benign	Het
Krt2	A	G	15: 101,816,497	V226A	probably damaging	Het
Lamc1	C	A	1: 153,234,580	Q1116H	possibly damaging	Het
Lamc1	T	G	1: 153,234,595	Q1111H	probably damaging	Het
Lamc1	T	C	1: 153,234,612	S1106G	probably benign	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp1	A	T	10: 127,575,286	D1399E	probably benign	Het
Ltbp4	G	T	7: 27,325,060	P715Q	probably damaging	Het
Mtor	T	C	4: 148,462,910	V450A	probably benign	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Myom1	A	T	17: 71,121,136	I1450F	probably damaging	Het
Naip6	A	G	13: 100,283,766	I1332T	possibly damaging	Het
Ncstn	A	G	1: 172,071,505	V353A	possibly damaging	Het
Nt5c3	T	C	6: 56,886,749	T149A	probably benign	Het
Olfr203	A	T	16: 59,303,989	I280F	probably damaging	Het
Olfr510	A	G	7: 108,668,157	H247R	probably damaging	Het
Paip1	T	C	13: 119,430,318	S54P	possibly damaging	Het
Prdm14	G	T	1: 13,125,744	A31E	probably benign	Het
Prr14l	A	G	5: 32,828,423	S1243P	probably damaging	Het
Prss1	T	C	6: 41,458,944	M1T	probably null	Het
Raver2	T	A	4: 101,102,950	V209D	probably damaging	Het
Scube1	T	A	15: 83,628,076		probably null	Het
Serpina3c	T	A	12: 104,151,546	I178F	probably damaging	Het
Slc16a13	A	T	11: 70,220,631	V16E	probably damaging	Het
Slc30a6	T	C	17: 74,415,645	S236P	possibly damaging	Het
Sobp	A	C	10: 43,022,693	S299A	probably damaging	Het
Sorcs3	C	A	19: 48,706,009	T574K	possibly damaging	Het
Trak2	A	T	1: 58,903,661	M862K	probably benign	Het
Ubox5	A	T	2: 130,600,710	V19E	probably damaging	Het
Vmn1r173	A	G	7: 23,702,735	T132A	probably benign	Het
Zfp820	T	C	17: 21,819,528	D273G	probably benign	Het

Other mutations in Grin2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01019:Grin2c	APN	11	115258110	missense	possibly damaging	0.94
IGL01306:Grin2c	APN	11	115256194	missense	probably benign	0.01
IGL01408:Grin2c	APN	11	115260882	missense	probably damaging	1.00
IGL01539:Grin2c	APN	11	115250106	missense	probably benign	0.32
IGL01931:Grin2c	APN	11	115253910	missense	probably damaging	1.00
IGL01964:Grin2c	APN	11	115253847	missense	probably damaging	1.00
IGL02796:Grin2c	APN	11	115250717	splice site	probably benign
IGL02956:Grin2c	APN	11	115257959	missense	possibly damaging	0.86
IGL03221:Grin2c	APN	11	115254044	splice site	probably benign
ANU23:Grin2c	UTSW	11	115256194	missense	probably benign	0.01
BB007:Grin2c	UTSW	11	115256237	missense	probably benign	0.01
BB017:Grin2c	UTSW	11	115256237	missense	probably benign	0.01
PIT4362001:Grin2c	UTSW	11	115249633	missense	probably benign
R0011:Grin2c	UTSW	11	115255750	missense	probably damaging	1.00
R0011:Grin2c	UTSW	11	115255750	missense	probably damaging	1.00
R0112:Grin2c	UTSW	11	115251134	missense	probably damaging	1.00
R0355:Grin2c	UTSW	11	115260728	splice site	probably benign
R0681:Grin2c	UTSW	11	115249653	missense	probably benign
R0791:Grin2c	UTSW	11	115250646	missense	probably damaging	1.00
R1512:Grin2c	UTSW	11	115253850	missense	probably damaging	1.00
R1572:Grin2c	UTSW	11	115256074	missense	possibly damaging	0.92
R1654:Grin2c	UTSW	11	115260853	missense	probably benign	0.21
R1803:Grin2c	UTSW	11	115260732	critical splice donor site	probably null
R1982:Grin2c	UTSW	11	115260905	missense	possibly damaging	0.96
R2050:Grin2c	UTSW	11	115257419	missense	possibly damaging	0.89
R2196:Grin2c	UTSW	11	115250666	missense	probably benign	0.34
R2442:Grin2c	UTSW	11	115251134	missense	probably damaging	1.00
R2509:Grin2c	UTSW	11	115251068	nonsense	probably null
R3440:Grin2c	UTSW	11	115250643	missense	probably damaging	1.00
R3965:Grin2c	UTSW	11	115260994	missense	probably damaging	1.00
R4618:Grin2c	UTSW	11	115252747	missense	probably damaging	1.00
R4735:Grin2c	UTSW	11	115249596	missense	possibly damaging	0.63
R4856:Grin2c	UTSW	11	115260790	missense	probably damaging	1.00
R4886:Grin2c	UTSW	11	115260790	missense	probably damaging	1.00
R5277:Grin2c	UTSW	11	115253813	missense	probably damaging	1.00
R5334:Grin2c	UTSW	11	115256055	missense	possibly damaging	0.76
R5553:Grin2c	UTSW	11	115252725	missense	probably null	0.96
R5711:Grin2c	UTSW	11	115250289	missense	probably benign	0.32
R5784:Grin2c	UTSW	11	115258295	missense	possibly damaging	0.94
R5849:Grin2c	UTSW	11	115260991	missense	probably benign
R6421:Grin2c	UTSW	11	115251130	missense	probably damaging	1.00
R6461:Grin2c	UTSW	11	115255696	missense	possibly damaging	0.96
R6658:Grin2c	UTSW	11	115258282	missense	possibly damaging	0.64
R7205:Grin2c	UTSW	11	115251050	missense	probably damaging	0.99
R7611:Grin2c	UTSW	11	115252685	missense	probably damaging	1.00
R7637:Grin2c	UTSW	11	115256259	splice site	probably null
R7751:Grin2c	UTSW	11	115253870	missense	probably damaging	1.00
R7847:Grin2c	UTSW	11	115260978	missense	possibly damaging	0.68
R7920:Grin2c	UTSW	11	115254144	missense	probably benign	0.33
R7930:Grin2c	UTSW	11	115256237	missense	probably benign	0.01
R7940:Grin2c	UTSW	11	115255281	missense	probably damaging	1.00
R7956:Grin2c	UTSW	11	115250148	missense	probably benign	0.16
R8081:Grin2c	UTSW	11	115249893	missense	probably damaging	0.98
R8249:Grin2c	UTSW	11	115253837	missense	probably damaging	0.98
R8447:Grin2c	UTSW	11	115257389	missense	probably benign	0.01
R9034:Grin2c	UTSW	11	115251239	missense	probably damaging	1.00
R9409:Grin2c	UTSW	11	115253280	missense	probably benign	0.06
R9432:Grin2c	UTSW	11	115251226	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCGAGTGAAGGCTTCTGCCACG -3'
(R):5'- GACATTGGGAGCACACAGTTAGGAC -3'

Sequencing Primer
(F):5'- AGAGGTGCGATCCCTGATG -3'
(R):5'- ATCTACAGCTGCTTCAACGG -3'

Posted On

2013-11-08