Mutagenetix > Incidental Mutation

Incidental Mutation 'R0792:Naip6'

82474

Institutional Source

Beutler Lab

Gene Symbol

Naip6

Ensembl Gene

ENSMUSG00000078942

Gene Name

NLR family, apoptosis inhibitory protein 6

Synonyms

Birc1f, Naip-rs4, Naip-rs4A

MMRRC Submission

038972-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.134) question?

Stock #

R0792 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100281121-100317674 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100283766 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1332 (I1332T)

Ref Sequence

ENSEMBL: ENSMUSP00000112867 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042220] [ENSMUST00000118574]

AlphaFold

Q9JIB6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042220
AA Change: I1332T

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000041766
Gene: ENSMUSG00000078942
AA Change: I1332T

Domain	Start	End	E-Value	Type
BIR	58	129	6.21e-20	SMART
BIR	157	229	8.04e-37	SMART
BIR	276	347	5.19e-31	SMART
Pfam:NACHT	464	618	7.6e-37	PFAM
low complexity region	851	862	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118574
AA Change: I1332T

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000112867
Gene: ENSMUSG00000078942
AA Change: I1332T

Domain	Start	End	E-Value	Type
BIR	58	129	6.21e-20	SMART
BIR	157	229	8.04e-37	SMART
BIR	276	347	5.19e-31	SMART
Pfam:NACHT	464	618	2.5e-35	PFAM
low complexity region	851	862	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224886

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.6%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Closest sequence match is AF381772. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	T	19: 45,933,868		probably null	Het
Acsl5	T	C	19: 55,280,492	V195A	probably benign	Het
Adgrb1	A	G	15: 74,580,617	M211V	probably damaging	Het
Ahnak	G	T	19: 9,016,734	M5127I	probably benign	Het
Akr1c13	T	C	13: 4,194,112	Y55H	probably damaging	Het
Ap3d1	A	T	10: 80,708,479	H1161Q	probably benign	Het
Atp2b2	C	T	6: 113,773,388	R625H	probably damaging	Het
Bdnf	G	A	2: 109,724,118	C239Y	probably damaging	Het
Bpifa5	G	T	2: 154,165,619		probably null	Het
C9	T	A	15: 6,486,762	F349I	probably damaging	Het
Ccdc180	T	C	4: 45,927,975	V1170A	possibly damaging	Het
Celsr1	A	G	15: 85,931,276	V1846A	probably benign	Het
Cep68	A	T	11: 20,240,652	L120H	possibly damaging	Het
Cntrl	T	A	2: 35,155,279	I781K	possibly damaging	Het
Cpne1	G	T	2: 156,077,419	Q343K	probably benign	Het
D3Ertd254e	A	G	3: 36,164,562	M244V	probably benign	Het
Dlc1	A	T	8: 36,938,548	I29K	probably benign	Het
Dnah9	T	C	11: 65,896,001	D3602G	possibly damaging	Het
Dock1	A	G	7: 134,874,150	S885G	probably benign	Het
Evpl	T	A	11: 116,227,723	Q686L	probably damaging	Het
Fmo6	C	T	1: 162,920,563	A311T	probably damaging	Het
Gli1	A	T	10: 127,332,577	M469K	probably damaging	Het
Grin2c	G	A	11: 115,250,646	P882L	probably damaging	Het
H2-Ob	C	T	17: 34,242,614	T109I	probably damaging	Het
Jpt2	C	A	17: 24,948,673	A101S	probably benign	Het
Krt2	A	G	15: 101,816,497	V226A	probably damaging	Het
Lamc1	C	A	1: 153,234,580	Q1116H	possibly damaging	Het
Lamc1	T	G	1: 153,234,595	Q1111H	probably damaging	Het
Lamc1	T	C	1: 153,234,612	S1106G	probably benign	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp1	A	T	10: 127,575,286	D1399E	probably benign	Het
Ltbp4	G	T	7: 27,325,060	P715Q	probably damaging	Het
Mtor	T	C	4: 148,462,910	V450A	probably benign	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Myom1	A	T	17: 71,121,136	I1450F	probably damaging	Het
Ncstn	A	G	1: 172,071,505	V353A	possibly damaging	Het
Nt5c3	T	C	6: 56,886,749	T149A	probably benign	Het
Olfr203	A	T	16: 59,303,989	I280F	probably damaging	Het
Olfr510	A	G	7: 108,668,157	H247R	probably damaging	Het
Paip1	T	C	13: 119,430,318	S54P	possibly damaging	Het
Prdm14	G	T	1: 13,125,744	A31E	probably benign	Het
Prr14l	A	G	5: 32,828,423	S1243P	probably damaging	Het
Prss1	T	C	6: 41,458,944	M1T	probably null	Het
Raver2	T	A	4: 101,102,950	V209D	probably damaging	Het
Scube1	T	A	15: 83,628,076		probably null	Het
Serpina3c	T	A	12: 104,151,546	I178F	probably damaging	Het
Slc16a13	A	T	11: 70,220,631	V16E	probably damaging	Het
Slc30a6	T	C	17: 74,415,645	S236P	possibly damaging	Het
Sobp	A	C	10: 43,022,693	S299A	probably damaging	Het
Sorcs3	C	A	19: 48,706,009	T574K	possibly damaging	Het
Trak2	A	T	1: 58,903,661	M862K	probably benign	Het
Ubox5	A	T	2: 130,600,710	V19E	probably damaging	Het
Vmn1r173	A	G	7: 23,702,735	T132A	probably benign	Het
Zfp820	T	C	17: 21,819,528	D273G	probably benign	Het

Other mutations in Naip6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00677:Naip6	APN	13	100316017	missense	probably benign	0.03
IGL01123:Naip6	APN	13	100304438	missense	probably benign	0.02
IGL01151:Naip6	APN	13	100299093	missense	probably benign	0.00
IGL01382:Naip6	APN	13	100299856	missense	possibly damaging	0.95
IGL01415:Naip6	APN	13	100303290	missense	probably benign	0.17
IGL01654:Naip6	APN	13	100299345	missense	probably benign	0.00
IGL01662:Naip6	APN	13	100300354	missense	probably damaging	1.00
IGL01726:Naip6	APN	13	100303252	missense	probably benign	0.02
IGL01810:Naip6	APN	13	100288095	splice site	probably benign
IGL01867:Naip6	APN	13	100300312	missense	probably benign	0.40
IGL01926:Naip6	APN	13	100300196	missense	probably damaging	1.00
IGL01964:Naip6	APN	13	100298730	splice site	probably benign
IGL02145:Naip6	APN	13	100296978	missense	possibly damaging	0.77
IGL02160:Naip6	APN	13	100299425	missense	probably benign	0.01
IGL02214:Naip6	APN	13	100316059	missense	probably damaging	1.00
IGL02342:Naip6	APN	13	100303240	missense	possibly damaging	0.69
IGL02568:Naip6	APN	13	100316272	missense	probably damaging	1.00
IGL02573:Naip6	APN	13	100299471	nonsense	probably null
IGL02680:Naip6	APN	13	100283748	missense	probably benign
IGL02829:Naip6	APN	13	100300765	missense	probably benign	0.11
IGL02833:Naip6	APN	13	100299613	missense	probably damaging	1.00
IGL02851:Naip6	APN	13	100300660	missense	probably benign	0.01
IGL02860:Naip6	APN	13	100300476	missense	possibly damaging	0.95
IGL02886:Naip6	APN	13	100300476	missense	possibly damaging	0.95
IGL03155:Naip6	APN	13	100316424	missense	possibly damaging	0.62
R0032:Naip6	UTSW	13	100303237	missense	probably benign	0.00
R0310:Naip6	UTSW	13	100308213	missense	possibly damaging	0.72
R0437:Naip6	UTSW	13	100296924	missense	possibly damaging	0.75
R0472:Naip6	UTSW	13	100302260	missense	probably benign	0.02
R0560:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R0638:Naip6	UTSW	13	100300528	missense	probably benign	0.00
R0963:Naip6	UTSW	13	100316475	missense	probably benign	0.11
R1102:Naip6	UTSW	13	100304415	missense	possibly damaging	0.62
R1278:Naip6	UTSW	13	100300362	missense	probably damaging	1.00
R1462:Naip6	UTSW	13	100300240	missense	possibly damaging	0.64
R1462:Naip6	UTSW	13	100300240	missense	possibly damaging	0.64
R1544:Naip6	UTSW	13	100316475	missense	probably benign
R1595:Naip6	UTSW	13	100299094	missense	probably damaging	0.96
R1749:Naip6	UTSW	13	100308255	missense	probably benign	0.03
R1838:Naip6	UTSW	13	100316136	missense	probably damaging	0.99
R1863:Naip6	UTSW	13	100300559	missense	probably benign	0.03
R1914:Naip6	UTSW	13	100299428	missense	probably benign	0.13
R2001:Naip6	UTSW	13	100300729	missense	probably benign	0.44
R2082:Naip6	UTSW	13	100304344	splice site	probably null
R2143:Naip6	UTSW	13	100299859	missense	probably damaging	1.00
R2174:Naip6	UTSW	13	100298987	missense	probably benign
R2266:Naip6	UTSW	13	100283559	missense	possibly damaging	0.46
R2284:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R2285:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R2286:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R2351:Naip6	UTSW	13	100283661	missense	probably damaging	1.00
R2363:Naip6	UTSW	13	100316420	missense	possibly damaging	0.90
R2445:Naip6	UTSW	13	100300668	missense	probably damaging	0.99
R2971:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R2975:Naip6	UTSW	13	100288187	missense	probably damaging	1.00
R3081:Naip6	UTSW	13	100300453	missense	probably benign
R3082:Naip6	UTSW	13	100316417	missense	probably benign	0.00
R3122:Naip6	UTSW	13	100316523	missense	probably benign	0.00
R3417:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R3943:Naip6	UTSW	13	100294739	missense	probably benign	0.01
R3944:Naip6	UTSW	13	100294739	missense	probably benign	0.01
R4080:Naip6	UTSW	13	100299307	missense	probably damaging	1.00
R4166:Naip6	UTSW	13	100316149	missense	probably benign	0.23
R4396:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R4397:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R4418:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R4512:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R4670:Naip6	UTSW	13	100294731	critical splice donor site	probably null
R4671:Naip6	UTSW	13	100294731	critical splice donor site	probably null
R4722:Naip6	UTSW	13	100307072	missense	possibly damaging	0.72
R4811:Naip6	UTSW	13	100285791	missense	probably damaging	1.00
R4900:Naip6	UTSW	13	100296969	missense	probably damaging	0.99
R5162:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R5316:Naip6	UTSW	13	100283782	missense	probably benign	0.00
R5403:Naip6	UTSW	13	100300077	missense	probably benign	0.12
R5437:Naip6	UTSW	13	100303304	nonsense	probably null
R5507:Naip6	UTSW	13	100298915	missense	probably benign	0.01
R5631:Naip6	UTSW	13	100300138	missense	probably benign	0.02
R5657:Naip6	UTSW	13	100300401	missense	probably benign
R5684:Naip6	UTSW	13	100300380	missense	probably damaging	1.00
R5786:Naip6	UTSW	13	100300216	missense	probably benign
R5787:Naip6	UTSW	13	100300216	missense	probably benign
R5788:Naip6	UTSW	13	100300216	missense	probably benign
R5878:Naip6	UTSW	13	100299673	missense	probably damaging	1.00
R5895:Naip6	UTSW	13	100315992	missense	possibly damaging	0.90
R5898:Naip6	UTSW	13	100299321	missense	possibly damaging	0.93
R6113:Naip6	UTSW	13	100299286	missense	possibly damaging	0.96
R6141:Naip6	UTSW	13	100308233	missense	possibly damaging	0.91
R6199:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R6321:Naip6	UTSW	13	100300401	missense	probably benign
R6402:Naip6	UTSW	13	100300718	missense	probably benign	0.30
R6435:Naip6	UTSW	13	100294741	missense	probably benign	0.04
R6477:Naip6	UTSW	13	100316008	missense	probably damaging	1.00
R6601:Naip6	UTSW	13	100283758	missense	probably benign
R6638:Naip6	UTSW	13	100300401	missense	probably benign
R6639:Naip6	UTSW	13	100300401	missense	probably benign
R6804:Naip6	UTSW	13	100299167	missense	probably benign
R6922:Naip6	UTSW	13	100302198	missense	possibly damaging	0.88
R6975:Naip6	UTSW	13	100316265	missense	probably damaging	1.00
R7050:Naip6	UTSW	13	100315499	missense	probably damaging	1.00
R7135:Naip6	UTSW	13	100300419	missense	probably damaging	1.00
R7140:Naip6	UTSW	13	100300200	missense	possibly damaging	0.95
R7182:Naip6	UTSW	13	100316149	missense	probably benign	0.23
R7196:Naip6	UTSW	13	100300158	missense	probably benign	0.10
R7234:Naip6	UTSW	13	100315503	nonsense	probably null
R7259:Naip6	UTSW	13	100304355	missense	probably damaging	1.00
R7322:Naip6	UTSW	13	100299388	missense	possibly damaging	0.94
R7332:Naip6	UTSW	13	100300701	missense	possibly damaging	0.62
R7339:Naip6	UTSW	13	100316019	missense	probably damaging	1.00
R7353:Naip6	UTSW	13	100299751	missense	probably benign	0.00
R7485:Naip6	UTSW	13	100283851	missense	probably benign	0.07
R7597:Naip6	UTSW	13	100300600	missense	probably benign	0.08
R7835:Naip6	UTSW	13	100316004	missense	probably benign	0.19
R7840:Naip6	UTSW	13	100315471	missense	probably damaging	1.00
R8082:Naip6	UTSW	13	100300401	missense	probably benign
R8082:Naip6	UTSW	13	100300453	missense	probably benign
R8103:Naip6	UTSW	13	100301343	missense	probably benign	0.00
R8164:Naip6	UTSW	13	100316289	missense	probably benign	0.00
R8206:Naip6	UTSW	13	100294836	nonsense	probably null
R8258:Naip6	UTSW	13	100316412	missense	probably benign	0.02
R8259:Naip6	UTSW	13	100316412	missense	probably benign	0.02
R8348:Naip6	UTSW	13	100300386	missense	possibly damaging	0.61
R8405:Naip6	UTSW	13	100300276	missense	possibly damaging	0.89
R8406:Naip6	UTSW	13	100300276	missense	possibly damaging	0.89
R8441:Naip6	UTSW	13	100285757	missense	possibly damaging	0.77
R8448:Naip6	UTSW	13	100300386	missense	possibly damaging	0.61
R8465:Naip6	UTSW	13	100296915	missense	possibly damaging	0.95
R8501:Naip6	UTSW	13	100300276	missense	possibly damaging	0.89
R8502:Naip6	UTSW	13	100300276	missense	possibly damaging	0.89
R8687:Naip6	UTSW	13	100299128	missense	probably benign	0.10
R8806:Naip6	UTSW	13	100300653	missense	possibly damaging	0.93
R9186:Naip6	UTSW	13	100299882	missense	possibly damaging	0.89
R9340:Naip6	UTSW	13	100315986	missense	probably damaging	1.00
R9352:Naip6	UTSW	13	100301385	missense	possibly damaging	0.85
R9585:Naip6	UTSW	13	100300069	missense	probably damaging	0.96
R9597:Naip6	UTSW	13	100300138	missense	probably benign	0.02
R9601:Naip6	UTSW	13	100300453	missense	probably benign
X0066:Naip6	UTSW	13	100315462	nonsense	probably null
Z1177:Naip6	UTSW	13	100299417	missense	probably benign	0.20
Z1177:Naip6	UTSW	13	100300800	missense	probably damaging	1.00
Z1177:Naip6	UTSW	13	100316130	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGGAGAGAACGGGACTATCCATTTC -3'
(R):5'- CAACCAGGCTGCTGTTTGATGC -3'

Sequencing Primer
(F):5'- CGGGACTATCCATTTCCAGAAG -3'
(R):5'- CTTGTGAGCATTATTGAAGTCCTC -3'

Posted On

2013-11-08