Incidental Mutation 'R0792:C9'
ID82477
Institutional Source Beutler Lab
Gene Symbol C9
Ensembl Gene ENSMUSG00000022149
Gene Namecomplement component 9
Synonyms
MMRRC Submission 038972-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0792 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6445327-6498751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6486762 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 349 (F349I)
Ref Sequence ENSEMBL: ENSMUSP00000022749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022749]
Predicted Effect probably damaging
Transcript: ENSMUST00000022749
AA Change: F349I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022749
Gene: ENSMUSG00000022149
AA Change: F349I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
TSP1 56 106 1.8e-6 SMART
LDLa 111 147 2.7e-12 SMART
MACPF 304 519 2.9e-52 SMART
Blast:EGF 525 556 4e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127196
Predicted Effect probably benign
Transcript: ENSMUST00000147905
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the final component of the complement system. It participates in the formation of the Membrane Attack Complex (MAC). The MAC assembles on bacterial membranes to form a pore, permitting disruption of bacterial membrane organization. Mutations in this gene cause component C9 deficiency. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ahnak G T 19: 9,016,734 M5127I probably benign Het
Akr1c13 T C 13: 4,194,112 Y55H probably damaging Het
Ap3d1 A T 10: 80,708,479 H1161Q probably benign Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bdnf G A 2: 109,724,118 C239Y probably damaging Het
Bpifa5 G T 2: 154,165,619 probably null Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Cep68 A T 11: 20,240,652 L120H possibly damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Cpne1 G T 2: 156,077,419 Q343K probably benign Het
D3Ertd254e A G 3: 36,164,562 M244V probably benign Het
Dlc1 A T 8: 36,938,548 I29K probably benign Het
Dnah9 T C 11: 65,896,001 D3602G possibly damaging Het
Dock1 A G 7: 134,874,150 S885G probably benign Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Fmo6 C T 1: 162,920,563 A311T probably damaging Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C T 17: 34,242,614 T109I probably damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Krt2 A G 15: 101,816,497 V226A probably damaging Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Ltbp4 G T 7: 27,325,060 P715Q probably damaging Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Naip6 A G 13: 100,283,766 I1332T possibly damaging Het
Ncstn A G 1: 172,071,505 V353A possibly damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Olfr203 A T 16: 59,303,989 I280F probably damaging Het
Olfr510 A G 7: 108,668,157 H247R probably damaging Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Prr14l A G 5: 32,828,423 S1243P probably damaging Het
Prss1 T C 6: 41,458,944 M1T probably null Het
Raver2 T A 4: 101,102,950 V209D probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Slc16a13 A T 11: 70,220,631 V16E probably damaging Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Sobp A C 10: 43,022,693 S299A probably damaging Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Ubox5 A T 2: 130,600,710 V19E probably damaging Het
Vmn1r173 A G 7: 23,702,735 T132A probably benign Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Other mutations in C9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:C9 APN 15 6486656 missense probably benign 0.04
IGL00229:C9 APN 15 6483231 missense possibly damaging 0.68
IGL00647:C9 APN 15 6483083 missense probably benign 0.43
IGL01618:C9 APN 15 6459668 missense probably benign 0.38
IGL02530:C9 APN 15 6497132 missense probably benign
R0267:C9 UTSW 15 6467458 missense probably benign 0.00
R0477:C9 UTSW 15 6458183 missense probably benign 0.25
R0552:C9 UTSW 15 6445437 missense probably damaging 0.98
R0701:C9 UTSW 15 6467421 missense probably damaging 1.00
R0881:C9 UTSW 15 6458868 splice site probably benign
R1281:C9 UTSW 15 6489840 missense possibly damaging 0.80
R1384:C9 UTSW 15 6458934 missense probably benign 0.08
R1522:C9 UTSW 15 6486762 missense probably damaging 1.00
R1988:C9 UTSW 15 6483138 frame shift probably null
R2229:C9 UTSW 15 6445420 missense possibly damaging 0.95
R2406:C9 UTSW 15 6483299 missense possibly damaging 0.76
R3720:C9 UTSW 15 6483119 missense possibly damaging 0.95
R3723:C9 UTSW 15 6483080 missense possibly damaging 0.77
R3929:C9 UTSW 15 6467458 missense probably benign 0.00
R4371:C9 UTSW 15 6491484 missense probably damaging 1.00
R4615:C9 UTSW 15 6491463 missense probably damaging 0.99
R4616:C9 UTSW 15 6491463 missense probably damaging 0.99
R4618:C9 UTSW 15 6491463 missense probably damaging 0.99
R4749:C9 UTSW 15 6489830 missense probably benign 0.19
R4764:C9 UTSW 15 6459643 missense probably damaging 1.00
R5544:C9 UTSW 15 6497027 missense probably damaging 0.99
R5723:C9 UTSW 15 6486816 missense probably damaging 1.00
R5813:C9 UTSW 15 6497126 missense probably benign 0.05
R6735:C9 UTSW 15 6489906 missense probably benign 0.06
R6754:C9 UTSW 15 6489943 nonsense probably null
R6956:C9 UTSW 15 6445464 missense probably benign
R7706:C9 UTSW 15 6458921 missense probably benign 0.08
R7791:C9 UTSW 15 6489878 missense possibly damaging 0.82
R7893:C9 UTSW 15 6483245 missense possibly damaging 0.94
R7976:C9 UTSW 15 6483245 missense possibly damaging 0.94
Z1177:C9 UTSW 15 6491519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCACTGCTTGTCAAGATAGCAT -3'
(R):5'- GGCAACATTTAGAGCAATTTGTTCCCA -3'

Sequencing Primer
(F):5'- CTGCTTGTCAAGATAGCATGATTTG -3'
(R):5'- ACTGTTAGATGCTGAAGGGC -3'
Posted On2013-11-08