Incidental Mutation 'R0792:Krt2'
ID 82481
Institutional Source Beutler Lab
Gene Symbol Krt2
Ensembl Gene ENSMUSG00000064201
Gene Name keratin 2
Synonyms Krt2-17, Krt2-2, Krt2e
MMRRC Submission 038972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R0792 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 101810689-101818169 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101816497 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 226 (V226A)
Ref Sequence ENSEMBL: ENSMUSP00000023712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023712]
AlphaFold Q3TTY5
Predicted Effect probably damaging
Transcript: ENSMUST00000023712
AA Change: V226A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: V226A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 23 195 3.6e-26 PFAM
Filament 198 511 4.22e-152 SMART
low complexity region 520 533 N/A INTRINSIC
low complexity region 538 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ahnak G T 19: 9,016,734 M5127I probably benign Het
Akr1c13 T C 13: 4,194,112 Y55H probably damaging Het
Ap3d1 A T 10: 80,708,479 H1161Q probably benign Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bdnf G A 2: 109,724,118 C239Y probably damaging Het
Bpifa5 G T 2: 154,165,619 probably null Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Cep68 A T 11: 20,240,652 L120H possibly damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Cpne1 G T 2: 156,077,419 Q343K probably benign Het
D3Ertd254e A G 3: 36,164,562 M244V probably benign Het
Dlc1 A T 8: 36,938,548 I29K probably benign Het
Dnah9 T C 11: 65,896,001 D3602G possibly damaging Het
Dock1 A G 7: 134,874,150 S885G probably benign Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Fmo6 C T 1: 162,920,563 A311T probably damaging Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C T 17: 34,242,614 T109I probably damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Ltbp4 G T 7: 27,325,060 P715Q probably damaging Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Naip6 A G 13: 100,283,766 I1332T possibly damaging Het
Ncstn A G 1: 172,071,505 V353A possibly damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Olfr203 A T 16: 59,303,989 I280F probably damaging Het
Olfr510 A G 7: 108,668,157 H247R probably damaging Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Prr14l A G 5: 32,828,423 S1243P probably damaging Het
Prss1 T C 6: 41,458,944 M1T probably null Het
Raver2 T A 4: 101,102,950 V209D probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Slc16a13 A T 11: 70,220,631 V16E probably damaging Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Sobp A C 10: 43,022,693 S299A probably damaging Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Ubox5 A T 2: 130,600,710 V19E probably damaging Het
Vmn1r173 A G 7: 23,702,735 T132A probably benign Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Other mutations in Krt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Krt2 APN 15 101811211 missense probably benign 0.23
IGL01568:Krt2 APN 15 101813211 missense probably damaging 1.00
IGL01586:Krt2 APN 15 101811390 missense unknown
IGL01667:Krt2 APN 15 101816330 missense possibly damaging 0.85
IGL02017:Krt2 APN 15 101816504 missense probably damaging 1.00
IGL02022:Krt2 APN 15 101816518 missense probably damaging 1.00
IGL02538:Krt2 APN 15 101811154 missense unknown
IGL02959:Krt2 APN 15 101811328 missense unknown
IGL03295:Krt2 APN 15 101816429 missense probably damaging 0.99
R0195:Krt2 UTSW 15 101813191 nonsense probably null
R0472:Krt2 UTSW 15 101813253 missense probably damaging 1.00
R0749:Krt2 UTSW 15 101817663 missense unknown
R0785:Krt2 UTSW 15 101817921 missense unknown
R1232:Krt2 UTSW 15 101811784 missense probably damaging 1.00
R1281:Krt2 UTSW 15 101813292 missense probably damaging 1.00
R1770:Krt2 UTSW 15 101811154 missense unknown
R1783:Krt2 UTSW 15 101813973 missense probably damaging 1.00
R1795:Krt2 UTSW 15 101816426 missense possibly damaging 0.85
R2283:Krt2 UTSW 15 101814387 missense probably damaging 1.00
R3977:Krt2 UTSW 15 101811127 missense unknown
R4575:Krt2 UTSW 15 101814486 missense probably damaging 1.00
R4619:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4620:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4766:Krt2 UTSW 15 101813960 missense probably damaging 1.00
R4819:Krt2 UTSW 15 101811544 missense unknown
R4953:Krt2 UTSW 15 101813942 missense probably damaging 1.00
R5108:Krt2 UTSW 15 101813286 missense possibly damaging 0.88
R5973:Krt2 UTSW 15 101816312 missense probably damaging 0.99
R6122:Krt2 UTSW 15 101815914 missense probably damaging 1.00
R6180:Krt2 UTSW 15 101815044 missense probably benign 0.05
R6661:Krt2 UTSW 15 101815963 missense probably damaging 1.00
R6974:Krt2 UTSW 15 101817879 missense unknown
R6993:Krt2 UTSW 15 101815960 missense probably damaging 1.00
R7104:Krt2 UTSW 15 101815087 missense probably benign 0.09
R7573:Krt2 UTSW 15 101814519 missense probably benign 0.05
R7947:Krt2 UTSW 15 101816334 missense probably damaging 1.00
R8469:Krt2 UTSW 15 101816369 missense probably benign 0.22
R8805:Krt2 UTSW 15 101815944 missense possibly damaging 0.93
R9051:Krt2 UTSW 15 101817882 missense unknown
R9118:Krt2 UTSW 15 101814541 missense probably damaging 0.99
R9230:Krt2 UTSW 15 101817513 missense probably benign 0.39
R9257:Krt2 UTSW 15 101816491 missense probably benign 0.05
R9424:Krt2 UTSW 15 101811357 missense unknown
R9569:Krt2 UTSW 15 101816489 missense probably damaging 1.00
R9576:Krt2 UTSW 15 101811357 missense unknown
RF020:Krt2 UTSW 15 101817968 missense unknown
Z1177:Krt2 UTSW 15 101811550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTCCACGAGATCCTGCATGTTG -3'
(R):5'- TGATGCAATCTGCTGCTGGGAC -3'

Sequencing Primer
(F):5'- GTTCAGCTCTGACTCCTGTGAG -3'
(R):5'- GGGGAATGCCTCAAGTCTG -3'
Posted On 2013-11-08